Rmu_sc0008401.1_g000007

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008401.1
OG0017773
Physical Location & Seq
Reverse (-)
25828 .. 26625
798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008401.1_g000007.1.cds

Sequence Viewer

Length: 798 bp
atgccacgactatgggtgaaattaaagcgtttgtatctattttccatcctcggtgtttgcaatgatggtttaattagaagactgtttccgattggggaagctgagactattctgagtatccctcttcgtttgagaattgttgatgatagactggtatggcggttggagagagacgataagtactttgttaaaattgtttaccgtctttcatttgctaattctactactagaactccctttgaattctcagttggtgttggtgttgatatttggaagaaactttggaaggtggtgaatcccaactttgcaataattcatacttggagagtgtgtcttgatatcctaccctccatggagagaattgcttcacgcagagtgcctatagcttcacaggtttgtgttctatgtgaaaatgctattgaaacaatattgcatatttgccacgattgccctttcacaaagcagattttgcaatccaatggagtgcttcttggggattgctacagtcctcaagtagttgtgtgtgagctgttggactggttgtgtctctgcactaaggaattgtcattgcaaagtttaggagaactagtgtacttgttgtggggaattaggaaggaacaaaactccagagtatgggataataacaatggccgttcttgtgatgtgttgctcaagattactgcccgtctacaggaatttcagtttaactttgccaagccggctggccggtggaactggcaggtcaaggttagtttggtggtctgctccctcacctggtccgtacaaaatcaattttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

265

Amino Acids

30.8

Weight (kDa)

9.03

Isoelectric Point (pI)

43.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 730
AccB7I CCANNNNNTGG 1 cut(s) 633
AccI GTMKAC 1 cut(s) 688
AciI CCGC 1 cut(s) 160
AcoI YGGCCR 2 cut(s) 649, 724
AcsI RAATTY 2 cut(s) 242, 695
AfaI GTAC 3 cut(s) 182, 593, 783
AfiI CCNNNNNNNGG 3 cut(s) 633, 691, 774
AgsI TTSAA 2 cut(s) 242, 422
AhlI ACTAGT 1 cut(s) 586
AjnI CCWGG 1 cut(s) 773
AjuI GAANNNNNNNTTGG 2 cut(s) 234, 266
AluBI AGCT 3 cut(s) 101, 386, 529
AluI AGCT 3 cut(s) 101, 386, 529
Alw26I GTCTC 3 cut(s) 98, 165, 551
AoxI GGCC 2 cut(s) 649, 724
ApoI RAATTY 2 cut(s) 242, 695
Asp700I GAANNNNTTC 1 cut(s) 364
AspS9I GGNCC 1 cut(s) 777
AsuHPI GGTGA 3 cut(s) 28, 304, 763
AvaII GGWCC 1 cut(s) 777
BbsI GAAGAC 1 cut(s) 85
BccI CCATC 2 cut(s) 53, 59
BceAI ACGGC 1 cut(s) 636
BciT130I CCWGG 1 cut(s) 775
BciVI GTATCC 1 cut(s) 128
BcoDI GTCTC 3 cut(s) 98, 165, 551
BcuI ACTAGT 1 cut(s) 586
BfaI CTAG 2 cut(s) 228, 587
BfmI CTRYAG 3 cut(s) 381, 502, 689
BfuAI ACCTGC 1 cut(s) 730
BfuI GTATCC 1 cut(s) 128
BglI GCCNNNNNGGC 1 cut(s) 719
BmcAI AGTACT 1 cut(s) 182
Bme1390I CCNGG 1 cut(s) 775
Bme18I GGWCC 1 cut(s) 777
BmgT120I GGNCC 1 cut(s) 777
BmrFI CCNGG 1 cut(s) 775
BpiI GAAGAC 1 cut(s) 85
BplI GAGNNNNNCTC 2 cut(s) 106, 138
BpmI CTGGAG 1 cut(s) 610
BpuEI CTTGAG 2 cut(s) 495, 656
BsaJI CCNNGG 2 cut(s) 49, 351
BsaXI ACNNNNNCTCC 6 cut(s) 217, 247, 316, 346, 573, 603
Bsc4I CCNNNNNNNGG 3 cut(s) 633, 691, 774
Bse118I RCCGGY 2 cut(s) 718, 726
Bse1I ACTGG 3 cut(s) 156, 542, 740
Bse3DI GCAATG 2 cut(s) 67, 566
BseBI CCWGG 1 cut(s) 775
BseDI CCNNGG 2 cut(s) 49, 351
BseGI GGATG 1 cut(s) 45
BseLI CCNNNNNNNGG 3 cut(s) 633, 691, 774
BseMI GCAATG 2 cut(s) 67, 566
BseMII CTCAG 3 cut(s) 93, 104, 261
BseNI ACTGG 3 cut(s) 156, 542, 740
BsgI GTGCAG 1 cut(s) 535
BshFI GGCC 2 cut(s) 651, 726
BsiSI CCGG 2 cut(s) 719, 727
BslI CCNNNNNNNGG 3 cut(s) 633, 691, 774
BsmAI GTCTC 3 cut(s) 98, 165, 551
BsmBI CGTCTC 1 cut(s) 165
BsnI GGCC 2 cut(s) 651, 726
Bsp19I CCATGG 1 cut(s) 351
BspACI CCGC 1 cut(s) 160
BspANI GGCC 2 cut(s) 651, 726
BspCNI CTCAG 3 cut(s) 94, 105, 260
BspMI ACCTGC 1 cut(s) 730
BsrDI GCAATG 2 cut(s) 67, 566
BsrFI RCCGGY 2 cut(s) 718, 726
BsrI ACTGG 3 cut(s) 156, 542, 740
BssAI RCCGGY 2 cut(s) 718, 726
BssECI CCNNGG 2 cut(s) 49, 351
BssT1I CCWWGG 1 cut(s) 351
Bst2UI CCWGG 1 cut(s) 775
Bst4CI ACNGT 3 cut(s) 84, 203, 506
Bst6I CTCTTC 1 cut(s) 129
BstAPI GCANNNNNTGC 1 cut(s) 469
BstC8I GCNNGC 2 cut(s) 720, 724
BstDEI CTNAG 4 cut(s) 102, 113, 247, 555
BstDSI CCRYGG 1 cut(s) 351
BstF5I GGATG 1 cut(s) 45
BstMAI GTCTC 3 cut(s) 98, 165, 551
BstMWI GCNNNNNNNGC 3 cut(s) 447, 469, 719
BstNI CCWGG 1 cut(s) 775
BstSCI CCNGG 1 cut(s) 773
BstSFI CTRYAG 3 cut(s) 381, 502, 689
BstV2I GAAGAC 1 cut(s) 85
BstXI CCANNNNNNTGG 1 cut(s) 12
BsuI GTATCC 1 cut(s) 128
BsuRI GGCC 2 cut(s) 651, 726
BtgI CCRYGG 1 cut(s) 351
BtsCI GGATG 1 cut(s) 45
BveI ACCTGC 1 cut(s) 730
Cac8I GCNNGC 2 cut(s) 720, 724
Cfr10I RCCGGY 2 cut(s) 718, 726
Cfr13I GGNCC 1 cut(s) 777
CsiI ACCWGGT 1 cut(s) 773
Csp6I GTAC 3 cut(s) 181, 592, 782
CviAII CATG 1 cut(s) 352
CviJI RGCY 7 cut(s) 101, 386, 529, 651, 718, 722, 726
CviKI_1 RGCY 7 cut(s) 101, 386, 529, 651, 718, 722, 726
CviQI GTAC 3 cut(s) 181, 592, 782
DdeI CTNAG 4 cut(s) 102, 113, 247, 555
EaeI YGGCCR 2 cut(s) 649, 724
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
Eco130I CCWWGG 1 cut(s) 351
Eco32I GATATC 1 cut(s) 340
Eco47I GGWCC 1 cut(s) 777
EcoRI GAATTC 1 cut(s) 242
EcoRII CCWGG 1 cut(s) 773
EcoRV GATATC 1 cut(s) 340
EcoT14I CCWWGG 1 cut(s) 351
ErhI CCWWGG 1 cut(s) 351
Esp3I CGTCTC 1 cut(s) 165
FaeI CATG 1 cut(s) 355
FaiI YATR 8 cut(s) 13, 157, 318, 353, 383, 406, 435, 634
FatI CATG 1 cut(s) 351
FblI GTMKAC 1 cut(s) 688
FokI GGATG 1 cut(s) 32
FspBI CTAG 2 cut(s) 228, 587
GsuI CTGGAG 1 cut(s) 610
HaeIII GGCC 2 cut(s) 651, 726
HapII CCGG 2 cut(s) 719, 727
Hin1II CATG 1 cut(s) 355
HinfI GANTC 1 cut(s) 295
HpaII CCGG 2 cut(s) 719, 727
HphI GGTGA 3 cut(s) 28, 304, 763
Hpy166II GTNNAC 3 cut(s) 199, 592, 689
Hpy188I TCNGA 2 cut(s) 90, 114
Hpy188III TCNNGA 3 cut(s) 335, 627, 673
Hpy8I GTNNAC 3 cut(s) 199, 592, 689
HpyAV CCTTC 2 cut(s) 280, 607
HpyCH4III ACNGT 3 cut(s) 84, 203, 506
HpyCH4V TGCA 6 cut(s) 60, 308, 433, 472, 552, 571
HpyF10VI GCNNNNNNNGC 3 cut(s) 447, 469, 719
HpyF3I CTNAG 4 cut(s) 102, 113, 247, 555
Hsp92II CATG 1 cut(s) 355
KroI GCCGGC 1 cut(s) 718
KroNI GCCGGC 1 cut(s) 720
LmnI GCTCC 1 cut(s) 770
MabI ACCWGGT 1 cut(s) 773
MaeI CTAG 2 cut(s) 228, 587
MboII GAAGA 3 cut(s) 90, 116, 286
MmeI TCCRAC 2 cut(s) 144, 513
MnlI CCTC 5 cut(s) 59, 132, 358, 519, 779
MroNI GCCGGC 1 cut(s) 718
MroXI GAANNNNTTC 1 cut(s) 364
MseI TTAA 4 cut(s) 23, 71, 189, 705
MslI CAYNNNNRTG 1 cut(s) 10
MspI CCGG 2 cut(s) 719, 727
MspR9I CCNGG 1 cut(s) 775
MvaI CCWGG 1 cut(s) 775
MwoI GCNNNNNNNGC 3 cut(s) 447, 469, 719
NaeI GCCGGC 1 cut(s) 720
NcoI CCATGG 1 cut(s) 351
NgoMIV GCCGGC 1 cut(s) 718
NlaIII CATG 1 cut(s) 355
PdiI GCCGGC 1 cut(s) 720
PdmI GAANNNNTTC 1 cut(s) 364
PfeI GAWTC 1 cut(s) 295
PflMI CCANNNNNTGG 1 cut(s) 633
Psp6I CCWGG 1 cut(s) 773
PspGI CCWGG 1 cut(s) 773
PspPI GGNCC 1 cut(s) 777
RsaI GTAC 3 cut(s) 182, 593, 783
RsaNI GTAC 3 cut(s) 181, 592, 782
RseI CAYNNNNRTG 1 cut(s) 10
SaqAI TTAA 4 cut(s) 23, 71, 189, 705
Sau96I GGNCC 1 cut(s) 777
ScaI AGTACT 1 cut(s) 182
ScrFI CCNGG 1 cut(s) 775
SetI ASST 8 cut(s) 103, 291, 388, 396, 531, 744, 750, 776
SexAI ACCWGGT 1 cut(s) 773
SfcI CTRYAG 3 cut(s) 381, 502, 689
SinI GGWCC 1 cut(s) 777
SmiMI CAYNNNNRTG 1 cut(s) 10
SmlI CTYRAG 2 cut(s) 510, 671
SmoI CTYRAG 2 cut(s) 510, 671
SpeI ACTAGT 1 cut(s) 586
SsiI CCGC 1 cut(s) 160
SspI AATATT 1 cut(s) 429
SspMI CTAG 2 cut(s) 228, 587
StyD4I CCNGG 1 cut(s) 773
StyI CCWWGG 1 cut(s) 351
TaaI ACNGT 3 cut(s) 84, 203, 506
TatI WGTACW 2 cut(s) 180, 591
TfiI GAWTC 1 cut(s) 295
Tru1I TTAA 4 cut(s) 23, 71, 189, 705
Tru9I TTAA 4 cut(s) 23, 71, 189, 705
TspDTI ATGAA 2 cut(s) 198, 305
TspGWI ACGGA 1 cut(s) 769
Van91I CCANNNNNTGG 1 cut(s) 633
VpaK11BI GGWCC 1 cut(s) 777
XapI RAATTY 2 cut(s) 242, 695
XmiI GTMKAC 1 cut(s) 688
XmnI GAANNNNTTC 1 cut(s) 364
XspI CTAG 2 cut(s) 228, 587
ZrmI AGTACT 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.