Rmu_sc0034598.1_g000001

ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034598.1
Physical Location & Seq
Reverse (-)
1 .. 412
412 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034598.1_g000001.1.cds

Sequence Viewer

Length: 271 bp
atgaataaccagaagattcattggaaaccttggaaggctcttagtaaccctaaggaggaagggggtttggggtttcgtagtttgactgattttaataatgccatgctagctaagcaggcctggagggtggttaacaaccctctatctttgagtgctcggatcttcaaggctccttattttccagaagattctttttggactgtggaacctcatgcttctccgtcttactcatggacaagcatcttctcaactagagatatgctacgcaagg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.47

Weight (kDa)

9.9

Isoelectric Point (pI)

35.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 167
AfiI CCNNNNNNNGG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 166
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
Alw21I GWGCWC 1 cut(s) 157
AlwI GGATC 1 cut(s) 167
AoxI GGCC 1 cut(s) 117
AsuNHI GCTAGC 1 cut(s) 106
AxyI CCTNAGG 1 cut(s) 51
Bbv12I GWGCWC 1 cut(s) 157
BciT130I CCWGG 1 cut(s) 121
BfaI CTAG 2 cut(s) 107, 252
BlpI GCTNAGC 1 cut(s) 111
Bme1390I CCNGG 1 cut(s) 121
BmiI GGNNCC 2 cut(s) 171, 207
BmrFI CCNGG 1 cut(s) 121
BmsI GCATC 1 cut(s) 249
BmtI GCTAGC 1 cut(s) 110
BpmI CTGGAG 1 cut(s) 142
Bpu1102I GCTNAGC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 55
Bse21I CCTNAGG 1 cut(s) 51
BseBI CCWGG 1 cut(s) 121
BseDI CCNNGG 1 cut(s) 29
BseLI CCNNNNNNNGG 1 cut(s) 55
BshFI GGCC 1 cut(s) 119
BsiHKAI GWGCWC 1 cut(s) 157
BslI CCNNNNNNNGG 1 cut(s) 55
BsnI GGCC 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 157
Bsp143I GATC 1 cut(s) 159
Bsp1720I GCTNAGC 1 cut(s) 111
BspANI GGCC 1 cut(s) 119
BspLI GGNNCC 2 cut(s) 171, 207
BspOI GCTAGC 1 cut(s) 110
BspPI GGATC 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 29
BssMI GATC 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 29
Bst2UI CCWGG 1 cut(s) 121
Bst4CI ACNGT 1 cut(s) 202
BstC8I GCNNGC 2 cut(s) 108, 117
BstDEI CTNAG 3 cut(s) 41, 51, 111
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BstMWI GCNNNNNNNGC 3 cut(s) 107, 112, 116
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 159
BstYI RGATCY 1 cut(s) 159
Bsu36I CCTNAGG 1 cut(s) 51
BsuRI GGCC 1 cut(s) 119
Cac8I GCNNGC 2 cut(s) 108, 117
CviAII CATG 3 cut(s) 103, 212, 231
CviJI RGCY 4 cut(s) 38, 110, 119, 170
CviKI_1 RGCY 4 cut(s) 38, 110, 119, 170
DdeI CTNAG 3 cut(s) 41, 51, 111
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 29
Eco147I AGGCCT 1 cut(s) 119
Eco81I CCTNAGG 1 cut(s) 51
EcoRII CCWGG 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 29
ErhI CCWWGG 1 cut(s) 29
FaeI CATG 3 cut(s) 106, 215, 234
FaiI YATR 4 cut(s) 104, 213, 232, 260
FatI CATG 3 cut(s) 102, 211, 230
FspBI CTAG 2 cut(s) 107, 252
GsuI CTGGAG 1 cut(s) 142
HaeIII GGCC 1 cut(s) 119
Hin1II CATG 3 cut(s) 106, 215, 234
HincII GTYRAC 1 cut(s) 133
HindII GTYRAC 1 cut(s) 133
HinfI GANTC 2 cut(s) 16, 188
HpaI GTTAAC 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 1 cut(s) 182
Hpy8I GTNNAC 1 cut(s) 133
HpyAV CCTTC 2 cut(s) 28, 53
HpyCH4III ACNGT 1 cut(s) 202
HpyF10VI GCNNNNNNNGC 3 cut(s) 107, 112, 116
HpyF3I CTNAG 3 cut(s) 41, 51, 111
Hsp92II CATG 3 cut(s) 106, 215, 234
KspAI GTTAAC 1 cut(s) 133
Kzo9I GATC 1 cut(s) 159
LmnI GCTCC 1 cut(s) 175
LpnPI CCDG 5 cut(s) 23, 101, 106, 133, 195
LweI GCATC 1 cut(s) 249
MaeI CTAG 2 cut(s) 107, 252
MaeIII GTNAC 1 cut(s) 44
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 4 cut(s) 25, 154, 197, 235
MflI RGATCY 1 cut(s) 159
MhlI GDGCHC 1 cut(s) 157
MnlI CCTC 4 cut(s) 49, 117, 150, 219
MseI TTAA 2 cut(s) 93, 132
MspR9I CCNGG 1 cut(s) 121
MvaI CCWGG 1 cut(s) 121
MwoI GCNNNNNNNGC 3 cut(s) 107, 112, 116
NdeII GATC 1 cut(s) 159
NheI GCTAGC 1 cut(s) 106
NlaIII CATG 3 cut(s) 106, 215, 234
NlaIV GGNNCC 2 cut(s) 171, 207
PceI AGGCCT 1 cut(s) 119
PfeI GAWTC 2 cut(s) 16, 188
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
PspN4I GGNNCC 2 cut(s) 171, 207
PsuI RGATCY 1 cut(s) 159
SaqAI TTAA 2 cut(s) 93, 132
Sau3AI GATC 1 cut(s) 159
ScrFI CCNGG 1 cut(s) 121
SduI GDGCHC 1 cut(s) 157
SetI ASST 3 cut(s) 31, 112, 211
SfaNI GCATC 1 cut(s) 249
SseBI AGGCCT 1 cut(s) 119
SspMI CTAG 2 cut(s) 107, 252
StuI AGGCCT 1 cut(s) 119
StyD4I CCNGG 1 cut(s) 119
StyI CCWWGG 1 cut(s) 29
TaaI ACNGT 1 cut(s) 202
TfiI GAWTC 2 cut(s) 16, 188
Tru1I TTAA 2 cut(s) 93, 132
Tru9I TTAA 2 cut(s) 93, 132
TspDTI ATGAA 2 cut(s) 8, 17
TspGWI ACGGA 1 cut(s) 210
XspI CTAG 2 cut(s) 107, 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.