Rmu_sc0008510.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008510.1
Physical Location & Seq
Forward (+)
10 .. 948
939 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008510.1_g000001.1.cds

Sequence Viewer

Length: 939 bp
atgattgcctatggtattgctgtaagaatgtatgtcaaagctggctctttggaagatgcttgctctgttctggacacaatggacaaacaggagggaatagttccagacatctacatgttacgtgatatgttccgtatttatcaaaaatgtggcagacttgataagttgaaagatttgtactatcgaatcttgaagactagagtgacttgggatcaggaaatgtacaattgtgtcataaactgctgttctcgtgctttgccaattgatgagatctcagagatgtttgatcagatgcttcaacgtgggtttgtacctaataccataaccttcaatgtcatgcttgatgtatatgggaaagcaaagctcttaaagaaggctaggaagttgttcttgatggcccagaaatgggatctggttgatacaatctcttacaatactattatagctgcgtatgggagaaacagagacttcaaaagcatgtcttcaacggtacgagagatgcagtttaaaggattttcagtttcccttgaagtctacaatagtatgctgaatgcttatgggaaagaaagccaaatggagcggttcagaagcgttttgcaaagaatgaaggagacaagctgtgcttcggaccatcacacctacaacattatgatcaatatctatggagagcaaggatggattgatgaagttgctggggtgctgactgagttgaaagaatgtggactgagacctgatctgtgtagctataacacattgattaaggcatatggaattgcaggaatggtcgaagatgctgtccgtttgctcagggaaatgagagataatggtatagagcctgataagattacatacatcaatctgattgctgcactacgaaaaaatgatgaatatttggaggctgtaaagtggtccttgtggatgaagcagatgggattgtaa

Protein Analysis

312

Amino Acids

36.24

Weight (kDa)

8.0

Isoelectric Point (pI)

29.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013189)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 580
AccI GTMKAC 1 cut(s) 534
AciI CCGC 1 cut(s) 580
AclWI GGATC 2 cut(s) 219, 417
AfaI GTAC 4 cut(s) 179, 224, 312, 492
AfiI CCNNNNNNNGG 2 cut(s) 405, 406
AflIII ACRYGT 1 cut(s) 114
AgsI TTSAA 8 cut(s) 169, 193, 299, 331, 472, 486, 530, 712
AluBI AGCT 5 cut(s) 41, 364, 446, 618, 744
AluI AGCT 5 cut(s) 41, 364, 446, 618, 744
Alw26I GTCTC 3 cut(s) 459, 605, 721
AlwI GGATC 2 cut(s) 219, 417
AoxI GGCC 1 cut(s) 396
ApeKI GCWGC 2 cut(s) 446, 866
ArsI GACNNNNNNTTYG 2 cut(s) 780, 812
Asp700I GAANNNNTTC 1 cut(s) 386
AspS9I GGNCC 3 cut(s) 397, 628, 909
AvaII GGWCC 2 cut(s) 628, 909
BauI CACGAG 1 cut(s) 249
BbsI GAAGAC 2 cut(s) 200, 474
BbvI GCAGC 2 cut(s) 433, 853
BccI CCATC 4 cut(s) 388, 639, 669, 922
BclI TGATCA 2 cut(s) 286, 651
BcoDI GTCTC 3 cut(s) 459, 605, 721
BfaI CTAG 2 cut(s) 198, 378
BglII AGATCT 1 cut(s) 270
BisI GCNGC 2 cut(s) 447, 867
BlsI GCNGC 2 cut(s) 448, 868
Bme18I GGWCC 2 cut(s) 628, 909
BmgT120I GGNCC 3 cut(s) 397, 628, 909
BmsI GCATC 4 cut(s) 46, 282, 489, 781
BpiI GAAGAC 2 cut(s) 200, 474
Bpu10I CCTNAGC 1 cut(s) 806
BsaAI YACGTR 1 cut(s) 122
BsaBI GATNNNNATC 1 cut(s) 656
BsaI GGTCTC 1 cut(s) 721
Bsc4I CCNNNNNNNGG 2 cut(s) 405, 406
Bse8I GATNNNNATC 1 cut(s) 656
BseGI GGATG 2 cut(s) 680, 924
BseJI GATNNNNATC 1 cut(s) 656
BseLI CCNNNNNNNGG 2 cut(s) 405, 406
BseMII CTCAG 4 cut(s) 288, 696, 716, 820
BseXI GCAGC 2 cut(s) 433, 853
BseYI CCCAGC 1 cut(s) 692
BsgI GTGCAG 1 cut(s) 852
BshFI GGCC 1 cut(s) 398
BslI CCNNNNNNNGG 2 cut(s) 405, 406
BsmAI GTCTC 3 cut(s) 459, 605, 721
BsmI GAATGC 1 cut(s) 556
BsnI GGCC 1 cut(s) 398
Bso31I GGTCTC 1 cut(s) 721
Bsp1407I TGTACA 1 cut(s) 222
Bsp143I GATC 6 cut(s) 211, 270, 286, 409, 651, 733
BspACI CCGC 1 cut(s) 580
BspANI GGCC 1 cut(s) 398
BspCNI CTCAG 4 cut(s) 287, 697, 717, 819
BspPI GGATC 2 cut(s) 219, 417
BspTNI GGTCTC 1 cut(s) 721
BsrBI CCGCTC 1 cut(s) 580
BsrGI TGTACA 1 cut(s) 222
BssMI GATC 6 cut(s) 211, 270, 286, 409, 651, 733
BssSI CACGAG 1 cut(s) 249
Bst2BI CACGAG 1 cut(s) 249
Bst4CI ACNGT 1 cut(s) 490
BstAUI TGTACA 1 cut(s) 222
BstBAI YACGTR 1 cut(s) 122
BstC8I GCNNGC 2 cut(s) 43, 61
BstDEI CTNAG 4 cut(s) 274, 705, 725, 806
BstF5I GGATG 2 cut(s) 680, 924
BstKTI GATC 6 cut(s) 214, 273, 289, 412, 654, 736
BstMAI GTCTC 3 cut(s) 459, 605, 721
BstMBI GATC 6 cut(s) 211, 270, 286, 409, 651, 733
BstNSI RCATGY 2 cut(s) 118, 481
BstV1I GCAGC 2 cut(s) 433, 853
BstV2I GAAGAC 2 cut(s) 200, 474
BstX2I RGATCY 2 cut(s) 270, 409
BstYI RGATCY 2 cut(s) 270, 409
BsuRI GGCC 1 cut(s) 398
BtsCI GGATG 2 cut(s) 680, 924
Cac8I GCNNGC 2 cut(s) 43, 61
Cfr13I GGNCC 3 cut(s) 397, 628, 909
Csp6I GTAC 4 cut(s) 178, 223, 311, 491
CviAII CATG 3 cut(s) 115, 337, 478
CviQI GTAC 4 cut(s) 178, 223, 311, 491
DdeI CTNAG 4 cut(s) 274, 705, 725, 806
DpnI GATC 6 cut(s) 213, 272, 288, 411, 653, 735
DpnII GATC 6 cut(s) 211, 270, 286, 409, 651, 733
DraI TTTAAA 1 cut(s) 508
Eco31I GGTCTC 1 cut(s) 721
Eco47I GGWCC 2 cut(s) 628, 909
FaeI CATG 3 cut(s) 118, 340, 481
FalI AAGNNNNNCTT 8 cut(s) 374, 406, 466, 498, 607, 639, 896, 928
FatI CATG 3 cut(s) 114, 336, 477
FauNDI CATATG 1 cut(s) 766
FbaI TGATCA 2 cut(s) 286, 651
FblI GTMKAC 1 cut(s) 534
Fnu4HI GCNGC 2 cut(s) 447, 867
FokI GGATG 2 cut(s) 687, 931
Fsp4HI GCNGC 2 cut(s) 447, 867
FspBI CTAG 2 cut(s) 198, 378
GluI GCNGC 2 cut(s) 447, 867
GsaI CCCAGC 1 cut(s) 696
HaeIII GGCC 1 cut(s) 398
Hin1II CATG 3 cut(s) 118, 340, 481
HinfI GANTC 1 cut(s) 186
Hpy166II GTNNAC 2 cut(s) 535, 722
Hpy188I TCNGA 5 cut(s) 277, 291, 587, 628, 861
Hpy188III TCNNGA 5 cut(s) 71, 104, 190, 215, 391
Hpy8I GTNNAC 2 cut(s) 535, 722
HpyAV CCTTC 3 cut(s) 337, 367, 601
HpyCH4III ACNGT 1 cut(s) 490
HpyCH4IV ACGT 2 cut(s) 121, 301
HpyCH4V TGCA 4 cut(s) 502, 598, 776, 869
HpyF3I CTNAG 4 cut(s) 274, 705, 725, 806
HpySE526I ACGT 2 cut(s) 121, 301
Hsp92II CATG 3 cut(s) 118, 340, 481
Ksp22I TGATCA 2 cut(s) 286, 651
Kzo9I GATC 6 cut(s) 211, 270, 286, 409, 651, 733
LmnI GCTCC 1 cut(s) 577
Lsp1109I GCAGC 2 cut(s) 433, 853
LweI GCATC 4 cut(s) 46, 282, 489, 781
MaeI CTAG 2 cut(s) 198, 378
MaeII ACGT 2 cut(s) 121, 301
MaeIII GTNAC 2 cut(s) 117, 202
MalI GATC 6 cut(s) 213, 272, 288, 411, 653, 735
MbiI CCGCTC 1 cut(s) 580
MboI GATC 6 cut(s) 211, 270, 286, 409, 651, 733
MboII GAAGA 4 cut(s) 65, 205, 474, 800
MfeI CAATTG 2 cut(s) 226, 261
MflI RGATCY 2 cut(s) 270, 409
MluCI AATT 3 cut(s) 226, 261, 771
MnlI CCTC 2 cut(s) 85, 889
MroXI GAANNNNTTC 1 cut(s) 386
MseI TTAA 3 cut(s) 368, 507, 759
MslI CAYNNNNRTG 1 cut(s) 113
MunI CAATTG 2 cut(s) 226, 261
Mva1269I GAATGC 1 cut(s) 556
NdeI CATATG 1 cut(s) 766
NdeII GATC 6 cut(s) 211, 270, 286, 409, 651, 733
NlaIII CATG 3 cut(s) 118, 340, 481
NmuCI GTSAC 1 cut(s) 202
NspI RCATGY 2 cut(s) 118, 481
PciI ACATGT 1 cut(s) 114
PctI GAATGC 1 cut(s) 556
PdmI GAANNNNTTC 1 cut(s) 386
PfeI GAWTC 1 cut(s) 186
PkrI GCNGC 2 cut(s) 448, 868
Ppu21I YACGTR 1 cut(s) 122
PscI ACATGT 1 cut(s) 114
PspFI CCCAGC 1 cut(s) 692
PspPI GGNCC 3 cut(s) 397, 628, 909
PsuI RGATCY 2 cut(s) 270, 409
RsaI GTAC 4 cut(s) 179, 224, 312, 492
RsaNI GTAC 4 cut(s) 178, 223, 311, 491
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 3 cut(s) 368, 507, 759
SatI GCNGC 2 cut(s) 447, 867
Sau3AI GATC 6 cut(s) 211, 270, 286, 409, 651, 733
Sau96I GGNCC 3 cut(s) 397, 628, 909
SfaNI GCATC 4 cut(s) 46, 282, 489, 781
SinI GGWCC 2 cut(s) 628, 909
SmiMI CAYNNNNRTG 1 cut(s) 113
Sse9I AATT 3 cut(s) 226, 261, 771
SsiI CCGC 1 cut(s) 580
SspI AATATT 1 cut(s) 890
SspMI CTAG 2 cut(s) 198, 378
TaaI ACNGT 1 cut(s) 490
TaiI ACGT 2 cut(s) 124, 304
TaqI TCGA 2 cut(s) 184, 786
TasI AATT 3 cut(s) 226, 261, 771
TatI WGTACW 2 cut(s) 177, 222
TfiI GAWTC 1 cut(s) 186
Tru1I TTAA 3 cut(s) 368, 507, 759
Tru9I TTAA 3 cut(s) 368, 507, 759
TseFI GTSAC 1 cut(s) 202
TseI GCWGC 2 cut(s) 446, 866
Tsp45I GTSAC 1 cut(s) 202
TspDTI ATGAA 4 cut(s) 620, 699, 900, 935
TspGWI ACGGA 2 cut(s) 122, 788
VpaK11BI GGWCC 2 cut(s) 628, 909
XceI RCATGY 2 cut(s) 118, 481
XmiI GTMKAC 1 cut(s) 534
XmnI GAANNNNTTC 1 cut(s) 386
XspI CTAG 2 cut(s) 198, 378
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.