Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008536.1

Orthogroup ID

OG0008272

Physical Location & Seq

Genomic Coordinates Reverse (-)

11627 .. 14605

Gene Structure 2979 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008536.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1680 bp

atgtcttccagtatggaagaagcttcagcaggacaacaagaacaacctacccgaagattacagatttacaccacctctgatactgtctctcccttctggagagagaagtatgaaagagaggctaagaagtactgggatgtcttttataagcgacatcaagataggttttttaaagatcggcactacttggacaaggaatggggccaatacttttctggagctgggcagaaagttgttttagaggttggctgtggagctggaaacactatttttccactggttgcgatatatgcagacatttttgtccatgcttgtgatttttcaccaaatgctgttaacttggttaagaaacataaagattttacagagtccagagttaatgcattcgtttgtgatttgaccattgacgatctgagcaagcagatatctccatcttcagtagatattgtaaccatgatttttgtgttatctgcagtatctccggagaagatgtctctggtagtgcagaatattagaaagattctcaagccaaatggtcgtgtgctatttcgcgattatgctactggtgaccttgctcaggaaagattaaattgcaaggaccaaaagattagtgaaaacttttatgccaggggtgatggcactagggctttctacttctctaatgagttcttgacaagcttatttaaagaaaatggttttgatgttgaggaacttgatctgtgctgcaaacaagttgaaaaccggtcgcgggagttggtaatgaataggcggtgggttcaagctgtattctgcctttcagatggtacaaactccaccaccaactcagaagctgcaatcagaatagaccatcctggaatggagatggatgttgacaataacatcttgaagaaacctgtaaacgatttggaggttgacatgtccgacggtgtggcaacagaaatgtttggtcttccaacttcgactgatggtgataatgaggtcattgagctcgagctgggaggttggactttcaaaatcaaagtgctatccaaagagtaccaacacacctgcaaatcaactggtttaatgttatgggaatcagctcggtttatggctcctgttttagcaagaaatccagctattttttctgggaaacgggtgttggagttggggtctggctgtgcaggcatttgctctatgattgctgctggatctgcagaccttgtgttcgccactgatggagacacaaaagcactcgacctactgacagaaaatgtcatgtcaaatcttagaccgccaatttcggacaaatttactacaagaatattagagtggggaaataaagaccatatagaagccatcaagcaagttaacagtggaggatttgatatcatattaggcacggatgtcacttacatacctgaagctattttgcccttgtttcaaactgcaaaggagttgatttcatctaacaacaaggatcaccaagcagccctaatcctgtgtcatatttttcgtcgagtagatgaaccttccatactatcagcagcttctcgatttggtttcaagctagtcgataagtggcctgtagaaattcttattaatccatcacaaagcatcatcaattcttggttccctgaaaacggctcagcggatgtttcaagggggccgttaaatattttgtacttccacaaggagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Methyltransf_12 Methyltransf_16 Methyltransf_23 Methyltransf_25

Protein Analysis

559

Amino Acids

62.91

Weight (kDa)

5.37

Isoelectric Point (pI)

47.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008272)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G26200 AT2G26200
fragaria_vesca	FvH4_2g31511 FvH4_2g31511 FvH4_2g31511 FvH4_2g31511 FvH4_2g31511
malus_domestica	MD08G1065700.v1.1 MD15G1055800.v1.1
prunus_persica	Prupe.1G408900_v2.0.a1 Prupe.1G408900_v2.0.a1 Prupe.1G408900_v2.0.a1
pyrus_communis	pycom08g05430
rosa_chinensis	RchiOBHm_Chr6g0311271
rosa_multiflora	Rmu_sc0006559.1_g000001 Rmu_sc0008536.1_g000002 Rmu_sc0013795.1_g000002
rosa_roxburghii	Rroxscaffold_7G00157810
rosa_samantha	Rh6AG501600 Rh6BG512300 Rh6CG518000 Rh6DG504300
rosa_wichuraiana	Rw6G043680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	147
AarI	CACCTGC	1 cut(s)	1055
AasI	GACNNNNNNGTC	1 cut(s)	302
Acc36I	ACCTGC	1 cut(s)	1055
AccII	CGCG	2 cut(s)	552, 748
AccIII	TCCGGA	1 cut(s)	481
AciI	CCGC	4 cut(s)	748, 769, 1274, 1631
AclWI	GGATC	2 cut(s)	1198, 1467
AcsI	RAATTY	2 cut(s)	1289, 1572
AcuI	CTGAAG	3 cut(s)	9, 420, 1422
AfaI	GTAC	4 cut(s)	131, 805, 1037, 1664
AfiI	CCNNNNNNNGG	3 cut(s)	577, 748, 1622
AflIII	ACRYGT	1 cut(s)	915
AgeI	ACCGGT	1 cut(s)	741
AgsI	TTSAA	7 cut(s)	737, 779, 886, 1012, 1424, 1546, 1641
AjnI	CCWGG	2 cut(s)	626, 850
AjuI	GAANNNNNNNTTGG	2 cut(s)	1124, 1156
Alw21I	GWGCWC	1 cut(s)	990
Alw26I	GTCTC	3 cut(s)	91, 498, 1215
AlwI	GGATC	2 cut(s)	1198, 1467
AlwNI	CAGNNNCTG	1 cut(s)	830
Ama87I	CYCGRG	1 cut(s)	989
Aor13HI	TCCGGA	1 cut(s)	481
AoxI	GGCC	3 cut(s)	202, 1562, 1646
ApeKI	GCWGC	5 cut(s)	723, 830, 1184, 1469, 1526
ApoI	RAATTY	2 cut(s)	1289, 1572
ArsI	GACNNNNNNTTYG	2 cut(s)	1190, 1222
AseI	ATTAAT	1 cut(s)	1581
AsiGI	ACCGGT	1 cut(s)	741
AspS9I	GGNCC	3 cut(s)	202, 598, 1646
AsuHPI	GGTGA	5 cut(s)	315, 578, 644, 980, 1454
AvaI	CYCGRG	1 cut(s)	989
AvaII	GGWCC	1 cut(s)	598
BanII	GRGCYC	1 cut(s)	990
BbsI	GAAGAC	1 cut(s)	941
Bbv12I	GWGCWC	1 cut(s)	990
BbvI	GCAGC	5 cut(s)	710, 817, 1171, 1481, 1538
BccI	CCATC	9 cut(s)	439, 629, 794, 855, 856, 959, 1211, 1346, 1594
BceAI	ACGGC	2 cut(s)	1633, 1639
BciT130I	CCWGG	2 cut(s)	628, 852
BcoDI	GTCTC	3 cut(s)	91, 498, 1215
BfaI	CTAG	2 cut(s)	642, 1550
BfmI	CTRYAG	3 cut(s)	471, 1194, 1566
BfuAI	ACCTGC	1 cut(s)	1055
BisI	GCNGC	5 cut(s)	724, 831, 1185, 1470, 1527
BlpI	GCTNAGC	1 cut(s)	1627
BlsI	GCNGC	5 cut(s)	725, 832, 1186, 1471, 1528
BmcAI	AGTACT	1 cut(s)	131
Bme1390I	CCNGG	2 cut(s)	628, 852
Bme18I	GGWCC	1 cut(s)	598
BmeT110I	CYCGRG	1 cut(s)	989
BmgT120I	GGNCC	3 cut(s)	202, 598, 1646
BmiI	GGNNCC	4 cut(s)	203, 1095, 1613, 1647
BmrFI	CCNGG	2 cut(s)	628, 852
BmrI	ACTGGG	1 cut(s)	142
BmsI	GCATC	1 cut(s)	1605
BmuI	ACTGGG	1 cut(s)	142
BpiI	GAAGAC	1 cut(s)	941
BpmI	CTGGAG	2 cut(s)	118, 237
Bpu10I	CCTNAGC	1 cut(s)	576
Bpu1102I	GCTNAGC	1 cut(s)	1627
BpuEI	CTTGAG	1 cut(s)	509
BsaJI	CCNNGG	1 cut(s)	627
BsaWI	WCCGGW	2 cut(s)	481, 741
BsaXI	ACNNNNNCTCC	6 cut(s)	73, 103, 476, 506, 1136, 1166
Bsc4I	CCNNNNNNNGG	3 cut(s)	577, 748, 1622
Bse118I	RCCGGY	1 cut(s)	741
Bse1I	ACTGG	5 cut(s)	9, 137, 282, 568, 1063
BseAI	TCCGGA	1 cut(s)	481
BseBI	CCWGG	2 cut(s)	628, 852
BseDI	CCNNGG	1 cut(s)	627
BseGI	GGATG	5 cut(s)	142, 847, 871, 1390, 1639
BseLI	CCNNNNNNNGG	3 cut(s)	577, 748, 1622
BseMII	CTCAG	4 cut(s)	404, 590, 837, 1641
BseNI	ACTGG	5 cut(s)	9, 137, 282, 568, 1063
BseXI	GCAGC	5 cut(s)	710, 817, 1171, 1481, 1538
BseYI	CCCAGC	2 cut(s)	221, 994
BsgI	GTGCAG	2 cut(s)	524, 1182
Bsh1236I	CGCG	2 cut(s)	552, 748
Bsh1285I	CGRYCG	1 cut(s)	746
BshFI	GGCC	3 cut(s)	204, 1564, 1648
BshTI	ACCGGT	1 cut(s)	741
BsiEI	CGRYCG	1 cut(s)	746
BsiHKAI	GWGCWC	1 cut(s)	990
BsiHKCI	CYCGRG	1 cut(s)	989
BsiSI	CCGG	2 cut(s)	482, 742
BslI	CCNNNNNNNGG	3 cut(s)	577, 748, 1622
BsmAI	GTCTC	3 cut(s)	91, 498, 1215
BsmI	GAATGC	1 cut(s)	383
BsnI	GGCC	3 cut(s)	204, 1564, 1648
BsoBI	CYCGRG	1 cut(s)	989
Bsp1286I	GDGCHC	1 cut(s)	990
Bsp13I	TCCGGA	1 cut(s)	481
Bsp143I	GATC	5 cut(s)	175, 409, 715, 1190, 1459
Bsp1720I	GCTNAGC	1 cut(s)	1627
Bsp68I	TCGCGA	1 cut(s)	552
BspACI	CCGC	4 cut(s)	748, 769, 1274, 1631
BspANI	GGCC	3 cut(s)	204, 1564, 1648
BspCNI	CTCAG	4 cut(s)	405, 589, 836, 1640
BspEI	TCCGGA	1 cut(s)	481
BspFNI	CGCG	2 cut(s)	552, 748
BspLI	GGNNCC	4 cut(s)	203, 1095, 1613, 1647
BspMAI	CTGCAG	2 cut(s)	475, 1198
BspMI	ACCTGC	1 cut(s)	1055
BspPI	GGATC	2 cut(s)	1198, 1467
BsrFI	RCCGGY	1 cut(s)	741
BsrI	ACTGG	5 cut(s)	9, 137, 282, 568, 1063
BssAI	RCCGGY	1 cut(s)	741
BssECI	CCNNGG	1 cut(s)	627
BssMI	GATC	5 cut(s)	175, 409, 715, 1190, 1459
Bst2UI	CCWGG	2 cut(s)	628, 852
Bst4CI	ACNGT	3 cut(s)	85, 926, 1355
BstC8I	GCNNGC	2 cut(s)	419, 1165
BstDEI	CTNAG	6 cut(s)	123, 413, 576, 823, 1268, 1627
BstEII	GGTNACC	1 cut(s)	566
BstENI	CCTNNNNNAGG	1 cut(s)	575
BstF5I	GGATG	5 cut(s)	142, 847, 871, 1390, 1639
BstFNI	CGCG	2 cut(s)	552, 748
BstKTI	GATC	5 cut(s)	178, 412, 718, 1193, 1462
BstMAI	GTCTC	3 cut(s)	91, 498, 1215
BstMBI	GATC	5 cut(s)	175, 409, 715, 1190, 1459
BstMCI	CGRYCG	1 cut(s)	746
BstMWI	GCNNNNNNNGC	3 cut(s)	290, 1164, 1193
BstNI	CCWGG	2 cut(s)	628, 852
BstNSI	RCATGY	1 cut(s)	919
BstPI	GGTNACC	1 cut(s)	566
BstSCI	CCNGG	2 cut(s)	626, 850
BstSFI	CTRYAG	3 cut(s)	471, 1194, 1566
BstUI	CGCG	2 cut(s)	552, 748
BstV1I	GCAGC	5 cut(s)	710, 817, 1171, 1481, 1538
BstV2I	GAAGAC	1 cut(s)	941
BstX2I	RGATCY	1 cut(s)	1190
BstYI	RGATCY	1 cut(s)	1190
BsuRI	GGCC	3 cut(s)	204, 1564, 1648
BtsCI	GGATG	5 cut(s)	142, 847, 871, 1390, 1639
BtsIMutI	CAGTG	3 cut(s)	275, 1212, 1360
BtuMI	TCGCGA	1 cut(s)	552
BveI	ACCTGC	1 cut(s)	1055
Cac8I	GCNNGC	2 cut(s)	419, 1165
CaiI	CAGNNNCTG	1 cut(s)	830
Cfr10I	RCCGGY	1 cut(s)	741
Cfr13I	GGNCC	3 cut(s)	202, 598, 1646
Csp6I	GTAC	4 cut(s)	130, 804, 1036, 1663
CspAI	ACCGGT	1 cut(s)	741
CviAII	CATG	4 cut(s)	308, 454, 916, 1258
CviQI	GTAC	4 cut(s)	130, 804, 1036, 1663
DdeI	CTNAG	6 cut(s)	123, 413, 576, 823, 1268, 1627
DpnI	GATC	5 cut(s)	177, 411, 717, 1192, 1461
DpnII	GATC	5 cut(s)	175, 409, 715, 1190, 1459
DraI	TTTAAA	2 cut(s)	172, 685
DrdI	GACNNNNNNGTC	1 cut(s)	302
DseDI	GACNNNNNNGTC	1 cut(s)	302
Ecl136II	GAGCTC	1 cut(s)	988
Eco24I	GRGCYC	1 cut(s)	990
Eco32I	GATATC	2 cut(s)	426, 1369
Eco47I	GGWCC	1 cut(s)	598
Eco53kI	GAGCTC	1 cut(s)	988
Eco57I	CTGAAG	3 cut(s)	9, 420, 1422
Eco88I	CYCGRG	1 cut(s)	989
Eco91I	GGTNACC	1 cut(s)	566
EcoICRI	GAGCTC	1 cut(s)	988
EcoNI	CCTNNNNNAGG	1 cut(s)	575
EcoO65I	GGTNACC	1 cut(s)	566
EcoRII	CCWGG	2 cut(s)	626, 850
EcoRV	GATATC	2 cut(s)	426, 1369
EcoT22I	ATGCAT	1 cut(s)	385
EcoT38I	GRGCYC	1 cut(s)	990
FaeI	CATG	4 cut(s)	311, 457, 919, 1261
FatI	CATG	4 cut(s)	307, 453, 915, 1257
FauI	CCCGC	1 cut(s)	741
Fnu4HI	GCNGC	5 cut(s)	724, 831, 1185, 1470, 1527
FokI	GGATG	5 cut(s)	149, 834, 878, 1397, 1646
FriOI	GRGCYC	1 cut(s)	990
Fsp4HI	GCNGC	5 cut(s)	724, 831, 1185, 1470, 1527
FspBI	CTAG	2 cut(s)	642, 1550
GluI	GCNGC	5 cut(s)	724, 831, 1185, 1470, 1527
GsaI	CCCAGC	2 cut(s)	225, 998
GsuI	CTGGAG	2 cut(s)	118, 237
HaeIII	GGCC	3 cut(s)	204, 1564, 1648
HapII	CCGG	2 cut(s)	482, 742
Hin1II	CATG	4 cut(s)	311, 457, 919, 1261
HincII	GTYRAC	4 cut(s)	337, 871, 913, 1351
HindII	GTYRAC	4 cut(s)	337, 871, 913, 1351
HindIII	AAGCTT	2 cut(s)	21, 676
HinfI	GANTC	3 cut(s)	368, 520, 1076
HpaI	GTTAAC	2 cut(s)	337, 1351
HpaII	CCGG	2 cut(s)	482, 742
HphI	GGTGA	5 cut(s)	315, 578, 644, 980, 1454
Hpy166II	GTNNAC	5 cut(s)	337, 871, 898, 913, 1351
Hpy188I	TCNGA	7 cut(s)	79, 414, 799, 826, 839, 922, 1285
Hpy8I	GTNNAC	5 cut(s)	337, 871, 898, 913, 1351
Hpy99I	CGWCG	2 cut(s)	926, 1500
HpyAV	CCTTC	2 cut(s)	103, 1521
HpyCH4III	ACNGT	3 cut(s)	85, 926, 1355
HpyF10VI	GCNNNNNNNGC	3 cut(s)	290, 1164, 1193
HpyF3I	CTNAG	6 cut(s)	123, 413, 576, 823, 1268, 1627
Hsp92II	CATG	4 cut(s)	311, 457, 919, 1261
Kpn2I	TCCGGA	1 cut(s)	481
KspAI	GTTAAC	2 cut(s)	337, 1351
Kzo9I	GATC	5 cut(s)	175, 409, 715, 1190, 1459
LmnI	GCTCC	3 cut(s)	218, 254, 1099
Lsp1109I	GCAGC	5 cut(s)	710, 817, 1171, 1481, 1538
LweI	GCATC	1 cut(s)	1605
MaeI	CTAG	2 cut(s)	642, 1550
MaeIII	GTNAC	3 cut(s)	448, 566, 1387
MalI	GATC	5 cut(s)	177, 411, 717, 1192, 1461
MboI	GATC	5 cut(s)	175, 409, 715, 1190, 1459
MboII	GAAGA	6 cut(s)	29, 66, 426, 499, 898, 941
MflI	RGATCY	1 cut(s)	1190
MhlI	GDGCHC	1 cut(s)	990
MluCI	AATT	5 cut(s)	589, 1278, 1289, 1572, 1603
MlyI	GAGTC	1 cut(s)	377
MmeI	TCCRAC	4 cut(s)	945, 977, 983, 1122
MnlI	CCTC	8 cut(s)	85, 112, 235, 700, 901, 970, 992, 1352
Mph1103I	ATGCAT	1 cut(s)	385
MroI	TCCGGA	1 cut(s)	481
MslI	CAYNNNNRTG	1 cut(s)	312
MspA1I	CMGCKG	1 cut(s)	1631
MspI	CCGG	2 cut(s)	482, 742
MspR9I	CCNGG	2 cut(s)	628, 852
Mva1269I	GAATGC	1 cut(s)	383
MvaI	CCWGG	2 cut(s)	628, 852
MvnI	CGCG	2 cut(s)	552, 748
MwoI	GCNNNNNNNGC	3 cut(s)	290, 1164, 1193
NdeII	GATC	5 cut(s)	175, 409, 715, 1190, 1459
NlaIII	CATG	4 cut(s)	311, 457, 919, 1261
NlaIV	GGNNCC	4 cut(s)	203, 1095, 1613, 1647
NmuCI	GTSAC	2 cut(s)	566, 1387
NruI	TCGCGA	1 cut(s)	552
NsiI	ATGCAT	1 cut(s)	385
NspI	RCATGY	1 cut(s)	919
PaeR7I	CTCGAG	1 cut(s)	989
PaqCI	CACCTGC	1 cut(s)	1055
PciI	ACATGT	1 cut(s)	915
PctI	GAATGC	1 cut(s)	383
PfeI	GAWTC	2 cut(s)	520, 1076
PfoI	TCCNGGA	1 cut(s)	850
PinAI	ACCGGT	1 cut(s)	741
PkrI	GCNGC	5 cut(s)	725, 832, 1186, 1471, 1528
PleI	GAGTC	1 cut(s)	376
PpsI	GAGTC	1 cut(s)	376
PscI	ACATGT	1 cut(s)	915
PshBI	ATTAAT	1 cut(s)	1581
PsiI	TTATAA	1 cut(s)	147
Psp124BI	GAGCTC	1 cut(s)	990
Psp6I	CCWGG	2 cut(s)	626, 850
PspEI	GGTNACC	1 cut(s)	566
PspFI	CCCAGC	2 cut(s)	221, 994
PspGI	CCWGG	2 cut(s)	626, 850
PspN4I	GGNNCC	4 cut(s)	203, 1095, 1613, 1647
PspPI	GGNCC	3 cut(s)	202, 598, 1646
PspXI	VCTCGAGB	1 cut(s)	989
PsrI	GAACNNNNNNTAC	2 cut(s)	1500, 1532
PstI	CTGCAG	2 cut(s)	475, 1198
PstNI	CAGNNNCTG	1 cut(s)	830
PsuI	RGATCY	1 cut(s)	1190
RruI	TCGCGA	1 cut(s)	552
RsaI	GTAC	4 cut(s)	131, 805, 1037, 1664
RsaNI	GTAC	4 cut(s)	130, 804, 1036, 1663
RseI	CAYNNNNRTG	1 cut(s)	312
SacI	GAGCTC	1 cut(s)	990
SatI	GCNGC	5 cut(s)	724, 831, 1185, 1470, 1527
Sau3AI	GATC	5 cut(s)	175, 409, 715, 1190, 1459
Sau96I	GGNCC	3 cut(s)	202, 598, 1646
ScaI	AGTACT	1 cut(s)	131
SchI	GAGTC	1 cut(s)	377
ScrFI	CCNGG	2 cut(s)	628, 852
SduI	GDGCHC	1 cut(s)	990
SfaNI	GCATC	1 cut(s)	1605
SfcI	CTRYAG	3 cut(s)	471, 1194, 1566
Sfr274I	CTCGAG	1 cut(s)	989
SinI	GGWCC	1 cut(s)	598
SlaI	CTCGAG	1 cut(s)	989
SmiMI	CAYNNNNRTG	1 cut(s)	312
SmlI	CTYRAG	2 cut(s)	524, 989
SmoI	CTYRAG	2 cut(s)	524, 989
Sse9I	AATT	5 cut(s)	589, 1278, 1289, 1572, 1603
SsiI	CCGC	4 cut(s)	748, 769, 1274, 1631
SspI	AATATT	3 cut(s)	511, 1305, 1657
SspMI	CTAG	2 cut(s)	642, 1550
SstI	GAGCTC	1 cut(s)	990
StyD4I	CCNGG	2 cut(s)	626, 850
TaaI	ACNGT	3 cut(s)	85, 926, 1355
TaqI	TCGA	6 cut(s)	959, 990, 1236, 1498, 1534, 1554
TasI	AATT	5 cut(s)	589, 1278, 1289, 1572, 1603
TatI	WGTACW	2 cut(s)	129, 1662
TfiI	GAWTC	2 cut(s)	520, 1076
TscAI	CASTG	3 cut(s)	282, 1219, 1360
TseFI	GTSAC	2 cut(s)	566, 1387
TseI	GCWGC	5 cut(s)	723, 830, 1184, 1469, 1526
Tsp45I	GTSAC	2 cut(s)	566, 1387
TspDTI	ATGAA	4 cut(s)	126, 776, 1434, 1521
TspGWI	ACGGA	1 cut(s)	1397
TspRI	CASTG	3 cut(s)	282, 1219, 1360
VpaK11BI	GGWCC	1 cut(s)	598
VspI	ATTAAT	1 cut(s)	1581
XagI	CCTNNNNNAGG	1 cut(s)	575
XapI	RAATTY	2 cut(s)	1289, 1572
XceI	RCATGY	1 cut(s)	919
XcmI	CCANNNNNNNNNTGG	1 cut(s)	212
XhoI	CTCGAG	1 cut(s)	989
XspI	CTAG	2 cut(s)	642, 1550
ZrmI	AGTACT	1 cut(s)	131
Zsp2I	ATGCAT	1 cut(s)	385

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.