Rmu_sc0009725.1_g000001

Belongs to the expansin family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009725.1
Physical Location & Seq
Forward (+)
1103 .. 6009
4907 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009725.1_g000001.1.cds

Sequence Viewer

Length: 732 bp
atgactaaagaggcaatttctgctgggtggcatgctttgttgttggtagttatggctttcttctccgacaacacgaaattttgcactttccctctcatcccaaattacaagtctggagcttgtggctatggagaatatggaaggaccgtaaatgatggtcaagtatctgcagttgctaggctctacagaaatggcactggctgtggtggatgttaccaggttaggtgcatataccctccacattgcagtaatgatggggtgaatgcggtggtgacggactacggcgaaggagacagaactgacttcatcttcagccctagagcctatgcaaagttggcaaacaacccagcttcaacggaggttttatttgcttatggtgtggttgatatagaattcagaagaatcccttgccggtattcttcacccaacctggttttcaaggtccatgaacatagcaaatttcctgaatacttggctatagtcgttcaatatgtagctggccggaatgatatcacagctgttgagttctggcaggaggattgcaaacaatggagcagcatgcgtagagcatatggagcagtatgggacactccaaccccacctaggggttccattgacttgaggttccaagtgagtggcagcgcagggaacaaatgggtgcaggcatccaacgccatccctgctgattggaaggccggggctgcctatacatcagccattcagctcaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

243

Amino Acids

26.86

Weight (kDa)

8.07

Isoelectric Point (pI)

25.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014117)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G17030
fragaria_vesca FvH4_5g20290
malus_domestica MD04G1052600.v1.1 MD06G1047600.v1.1
prunus_persica Prupe.5G057900_v2.0.a1
pyrus_communis pycom06g04050
rosa_chinensis RchiOBHm_Chr7g0205401
rosa_laevigata RLG00000003384
rosa_multiflora Rmu_sc0009725.1_g000001 Rmu_ssc0000004.1_g000008
rosa_roxburghii Rroxscaffold_3G00252410
rosa_rugosa Rorug07G0091000
rosa_samantha Rh7AG220900 Rh7BG217200 Rh7CG234000 Rh7DG227900
rosa_wichuraiana Rw7G019090

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 266
AcoI YGGCCR 1 cut(s) 499
AcsI RAATTY 3 cut(s) 77, 392, 458
AcuI CTGAAG 1 cut(s) 295
AfiI CCNNNNNNNGG 3 cut(s) 603, 604, 605
AgsI TTSAA 3 cut(s) 354, 439, 488
AjnI CCWGG 2 cut(s) 216, 429
AjuI GAANNNNNNNTTGG 2 cut(s) 419, 451
AluBI AGCT 5 cut(s) 119, 350, 497, 518, 724
AluI AGCT 5 cut(s) 119, 350, 497, 518, 724
Alw26I GTCTC 1 cut(s) 285
AoxI GGCC 2 cut(s) 499, 693
ApeKI GCWGC 3 cut(s) 555, 639, 701
ApoI RAATTY 3 cut(s) 77, 392, 458
ArsI GACNNNNNNTTYG 2 cut(s) 95, 127
AspA2I CCTAGG 1 cut(s) 602
AspLEI GCGC 1 cut(s) 644
AspS9I GGNCC 2 cut(s) 144, 442
AsuC2I CCSGG 1 cut(s) 697
AsuHPI GGTGA 3 cut(s) 271, 283, 414
AvaII GGWCC 2 cut(s) 144, 442
AvrII CCTAGG 1 cut(s) 602
BbvI GCAGC 3 cut(s) 567, 651, 688
BccI CCATC 3 cut(s) 149, 248, 683
BceAI ACGGC 1 cut(s) 298
BciT130I CCWGG 2 cut(s) 218, 431
BcnI CCSGG 1 cut(s) 697
BcoDI GTCTC 1 cut(s) 285
BfaI CTAG 3 cut(s) 177, 318, 603
BfmI CTRYAG 3 cut(s) 168, 184, 477
BisI GCNGC 3 cut(s) 556, 640, 702
BlnI CCTAGG 1 cut(s) 602
BlsI GCNGC 3 cut(s) 557, 641, 703
Bme1390I CCNGG 3 cut(s) 218, 431, 697
Bme18I GGWCC 2 cut(s) 144, 442
BmgT120I GGNCC 2 cut(s) 144, 442
BmiI GGNNCC 2 cut(s) 610, 626
BmrFI CCNGG 3 cut(s) 218, 431, 697
BmsI GCATC 1 cut(s) 674
BpmI CTGGAG 1 cut(s) 135
BpuEI CTTGAG 1 cut(s) 640
BpuMI CCSGG 1 cut(s) 697
BsaJI CCNNGG 2 cut(s) 602, 696
Bsc4I CCNNNNNNNGG 3 cut(s) 603, 604, 605
Bse118I RCCGGY 1 cut(s) 411
Bse1I ACTGG 1 cut(s) 202
Bse3DI GCAATG 1 cut(s) 241
BseBI CCWGG 2 cut(s) 218, 431
BseDI CCNNGG 2 cut(s) 602, 696
BseGI GGATG 4 cut(s) 96, 215, 665, 675
BseLI CCNNNNNNNGG 3 cut(s) 603, 604, 605
BseMI GCAATG 1 cut(s) 241
BseNI ACTGG 1 cut(s) 202
BseXI GCAGC 3 cut(s) 567, 651, 688
BseYI CCCAGC 2 cut(s) 23, 346
BsgI GTGCAG 1 cut(s) 680
BshFI GGCC 2 cut(s) 501, 695
BsiSI CCGG 3 cut(s) 412, 502, 696
BslFI GGGAC 1 cut(s) 599
BslI CCNNNNNNNGG 3 cut(s) 603, 604, 605
BsmAI GTCTC 1 cut(s) 285
BsmFI GGGAC 1 cut(s) 599
BsmI GAATGC 1 cut(s) 268
BsnI GGCC 2 cut(s) 501, 695
BspACI CCGC 1 cut(s) 266
BspANI GGCC 2 cut(s) 501, 695
BspLI GGNNCC 2 cut(s) 610, 626
BspMAI CTGCAG 1 cut(s) 172
BsrDI GCAATG 1 cut(s) 241
BsrFI RCCGGY 1 cut(s) 411
BsrI ACTGG 1 cut(s) 202
BssAI RCCGGY 1 cut(s) 411
BssECI CCNNGG 2 cut(s) 602, 696
BssT1I CCWWGG 1 cut(s) 602
Bst2UI CCWGG 2 cut(s) 218, 431
Bst4CI ACNGT 1 cut(s) 148
BstAPI GCANNNNNTGC 1 cut(s) 20
BstC8I GCNNGC 4 cut(s) 33, 499, 560, 663
BstF5I GGATG 4 cut(s) 96, 215, 665, 675
BstHHI GCGC 1 cut(s) 644
BstMAI GTCTC 1 cut(s) 285
BstMWI GCNNNNNNNGC 6 cut(s) 20, 335, 575, 671, 680, 701
BstNI CCWGG 2 cut(s) 218, 431
BstNSI RCATGY 2 cut(s) 35, 562
BstSCI CCNGG 3 cut(s) 216, 429, 695
BstSFI CTRYAG 3 cut(s) 168, 184, 477
BstV1I GCAGC 3 cut(s) 567, 651, 688
BstXI CCANNNNNNTGG 1 cut(s) 635
BsuRI GGCC 2 cut(s) 501, 695
BtsCI GGATG 4 cut(s) 96, 215, 665, 675
BtsIMutI CAGTG 1 cut(s) 195
Cac8I GCNNGC 4 cut(s) 33, 499, 560, 663
CfoI GCGC 1 cut(s) 644
Cfr10I RCCGGY 1 cut(s) 411
Cfr13I GGNCC 2 cut(s) 144, 442
CsiI ACCWGGT 2 cut(s) 216, 429
CviAII CATG 3 cut(s) 32, 446, 559
EaeI YGGCCR 1 cut(s) 499
Eco130I CCWWGG 1 cut(s) 602
Eco32I GATATC 1 cut(s) 511
Eco47I GGWCC 2 cut(s) 144, 442
Eco57I CTGAAG 1 cut(s) 295
EcoRI GAATTC 1 cut(s) 392
EcoRII CCWGG 2 cut(s) 216, 429
EcoRV GATATC 1 cut(s) 511
EcoT14I CCWWGG 1 cut(s) 602
ErhI CCWWGG 1 cut(s) 602
FaeI CATG 3 cut(s) 35, 449, 562
FalI AAGNNNNNCTT 2 cut(s) 391, 423
FaqI GGGAC 1 cut(s) 599
FatI CATG 3 cut(s) 31, 445, 558
FauNDI CATATG 1 cut(s) 571
Fnu4HI GCNGC 3 cut(s) 556, 640, 702
FokI GGATG 4 cut(s) 83, 222, 652, 662
Fsp4HI GCNGC 3 cut(s) 556, 640, 702
FspBI CTAG 3 cut(s) 177, 318, 603
GlaI GCGC 1 cut(s) 643
GluI GCNGC 3 cut(s) 556, 640, 702
GsaI CCCAGC 2 cut(s) 27, 350
GsuI CTGGAG 1 cut(s) 135
HaeIII GGCC 2 cut(s) 501, 695
HapII CCGG 3 cut(s) 412, 502, 696
HhaI GCGC 1 cut(s) 644
Hin1II CATG 3 cut(s) 35, 449, 562
Hin6I GCGC 1 cut(s) 642
HinP1I GCGC 1 cut(s) 642
HinfI GANTC 1 cut(s) 402
HpaII CCGG 3 cut(s) 412, 502, 696
HphI GGTGA 3 cut(s) 271, 283, 414
Hpy188I TCNGA 2 cut(s) 67, 398
Hpy188III TCNNGA 2 cut(s) 114, 464
HpyAV CCTTC 3 cut(s) 135, 281, 685
HpyCH4III ACNGT 1 cut(s) 148
HpyCH4V TGCA 7 cut(s) 84, 170, 228, 246, 329, 543, 661
HpyF10VI GCNNNNNNNGC 6 cut(s) 20, 335, 575, 671, 680, 701
Hsp92II CATG 3 cut(s) 35, 449, 562
HspAI GCGC 1 cut(s) 642
LmnI GCTCC 3 cut(s) 116, 552, 575
Lsp1109I GCAGC 3 cut(s) 567, 651, 688
LweI GCATC 1 cut(s) 674
MabI ACCWGGT 2 cut(s) 216, 429
MaeI CTAG 3 cut(s) 177, 318, 603
MaeIII GTNAC 2 cut(s) 212, 271
MboII GAAGA 4 cut(s) 52, 301, 411, 411
MluCI AATT 6 cut(s) 15, 77, 103, 392, 458, 727
MmeI TCCRAC 3 cut(s) 90, 617, 693
MnlI CCTC 6 cut(s) 4, 102, 246, 352, 529, 615
MspA1I CMGCKG 1 cut(s) 518
MspI CCGG 3 cut(s) 412, 502, 696
MspR9I CCNGG 3 cut(s) 218, 431, 697
Mva1269I GAATGC 1 cut(s) 268
MvaI CCWGG 2 cut(s) 218, 431
MwoI GCNNNNNNNGC 6 cut(s) 20, 335, 575, 671, 680, 701
NciI CCSGG 1 cut(s) 697
NdeI CATATG 1 cut(s) 571
NlaIII CATG 3 cut(s) 35, 449, 562
NlaIV GGNNCC 2 cut(s) 610, 626
NmuCI GTSAC 1 cut(s) 271
NspI RCATGY 2 cut(s) 35, 562
PaeI GCATGC 2 cut(s) 35, 562
PctI GAATGC 1 cut(s) 268
PfeI GAWTC 1 cut(s) 402
PkrI GCNGC 3 cut(s) 557, 641, 703
Psp6I CCWGG 2 cut(s) 216, 429
PspFI CCCAGC 2 cut(s) 23, 346
PspGI CCWGG 2 cut(s) 216, 429
PspN4I GGNNCC 2 cut(s) 610, 626
PspPI GGNCC 2 cut(s) 144, 442
PstI CTGCAG 1 cut(s) 172
PvuII CAGCTG 1 cut(s) 518
SatI GCNGC 3 cut(s) 556, 640, 702
Sau96I GGNCC 2 cut(s) 144, 442
ScrFI CCNGG 3 cut(s) 218, 431, 697
SexAI ACCWGGT 2 cut(s) 216, 429
SfaNI GCATC 1 cut(s) 674
SfcI CTRYAG 3 cut(s) 168, 184, 477
SinI GGWCC 2 cut(s) 144, 442
SmlI CTYRAG 1 cut(s) 619
SmoI CTYRAG 1 cut(s) 619
SphI GCATGC 2 cut(s) 35, 562
Sse9I AATT 6 cut(s) 15, 77, 103, 392, 458, 727
SsiI CCGC 1 cut(s) 266
SspMI CTAG 3 cut(s) 177, 318, 603
StyD4I CCNGG 3 cut(s) 216, 429, 695
StyI CCWWGG 1 cut(s) 602
TaaI ACNGT 1 cut(s) 148
TasI AATT 6 cut(s) 15, 77, 103, 392, 458, 727
TfiI GAWTC 1 cut(s) 402
TscAI CASTG 1 cut(s) 202
TseFI GTSAC 1 cut(s) 271
TseI GCWGC 3 cut(s) 555, 639, 701
Tsp45I GTSAC 1 cut(s) 271
TspDTI ATGAA 2 cut(s) 295, 462
TspGWI ACGGA 2 cut(s) 290, 371
TspRI CASTG 1 cut(s) 202
VpaK11BI GGWCC 2 cut(s) 144, 442
XapI RAATTY 3 cut(s) 77, 392, 458
XceI RCATGY 2 cut(s) 35, 562
XmaJI CCTAGG 1 cut(s) 602
XspI CTAG 3 cut(s) 177, 318, 603
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.