Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0010073.1

Orthogroup ID

OG0011793

Physical Location & Seq

Genomic Coordinates Reverse (-)

57526 .. 60079

Gene Structure 2554 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0010073.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1269 bp

atgagaaccaaaacaacattcttcttttggctctctgccttggctattgcactagtttccattacctttgcactccgcagcttctcatctctttcctcaacttctgtaatctccaactttgtgcaaactggctccgatcttgccatgtttgatgtttttttcaggcaaagtgttgagaccttattgtcaaccgtgagaagcattgtgtccagacaccatcatcaccagcagaggataaactgcgacgaaaaatggaactcgaggctcatatccgaattaaatgtgtcacttgttttgactgttggcttaaatggctgcaccaactttagtagtgtgcaaaaggcagtagatgccgttcctgagcttagcactaataggacactcatcataatcgactcaggtacttacagggagaaggtgacagttaatgttagcaagaccaatttgatatttcaaggtcagggttatcttaacactgccatagcttggaatgactcggccaattcttctgggggtactggccgaagctcttcagtttctatatctgctcccaatttcactgcctacaacattagctttaagaacacagctccgccaccatcaaaaggcagaattggagcacaggcagtggcacttcgagtttctggagatcaagctgcattttatggatgtggtttctatggggcgcaagacactctcaatgacgaccgtggaagacattattttagagaatgtttcattcaaggatccatagatttcattttcggaagcgctagatcactatatgaggggtgcaccattaattcaatagcaaatccagtgaaaggtgggattccactgaaaggtaggataagtggagccatcacagcacaaggaaggcaatcgatgcaggagcaaagtgggtattcctttgtgaattgcagtattggaggaagtgggagagtgtggcttggtcgagcttggggagcttacgccactgtggttttctccaaaacgtacatgtctgacgttgttgcttcagatggttggaatgactggagtgacccttctagagatcagaaagtgttttatggggagtacgagtgcataggaccaggagcaaataatacaaatagggtctcatattcaaagcagctcaacgaatctgaagcagcaccctttttggatgtttcctacattgatggggatgaatggcttttatatactccactcttcagtcttcatgaagattaccatatgcacaattatcagtttacttatacttactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00040 ko01100 map00040 map01100

Pfam Domains

Protein Families

Pectinesterase

Protein Analysis

422

Amino Acids

46.52

Weight (kDa)

7.07

Isoelectric Point (pI)

38.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011793)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G36710
fragaria_vesca	FvH4_6g17090 FvH4_6g17090 FvH4_6g39480
malus_domestica	MD12G1104100.v1.1
prunus_persica	Prupe.7G123900_v2.0.a1 Prupe.7G123900_v2.0.a1 Prupe.7G123900_v2.0.a1 Prupe.7G123900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr3g0471171
rosa_laevigata	RLG00000020704 RLG00000024201
rosa_multiflora	Rmu_sc0010073.1_g000012
rosa_roxburghii	Rroxscaffold_6G00410260
rosa_rugosa	Rorug03G0115700 Rorug03G0115800
rosa_samantha	Rh3BG190300 Rh3CG180600
rosa_wichuraiana	Rw3G015540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	184
AccB7I	CCANNNNNTGG	1 cut(s)	486
AciI	CCGC	2 cut(s)	76, 593
AclWI	GGATC	2 cut(s)	741, 754
AcoI	YGGCCR	2 cut(s)	498, 520
AcuI	CTGAAG	4 cut(s)	516, 1002, 1167, 1198
AfaI	GTAC	4 cut(s)	403, 517, 998, 1079
AfeI	AGCGCT	1 cut(s)	772
AfiI	CCNNNNNNNGG	4 cut(s)	486, 605, 824, 842
AflIII	ACRYGT	1 cut(s)	999
AgsI	TTSAA	4 cut(s)	455, 743, 807, 1128
AhlI	ACTAGT	1 cut(s)	52
AjnI	CCWGG	1 cut(s)	1093
AjuI	GAANNNNNNNTTGG	1 cut(s)	34
Alw21I	GWGCWC	2 cut(s)	622, 797
Alw26I	GTCTC	2 cut(s)	170, 1123
Alw44I	GTGCAC	1 cut(s)	793
AlwI	GGATC	2 cut(s)	741, 754
Ama87I	CYCGRG	1 cut(s)	259
Aor51HI	AGCGCT	1 cut(s)	772
AoxI	GGCC	2 cut(s)	498, 520
ApaLI	GTGCAC	1 cut(s)	793
ApeKI	GCWGC	5 cut(s)	78, 315, 656, 1132, 1151
AseI	ATTAAT	1 cut(s)	801
Asp700I	GAANNNNTTC	1 cut(s)	529
AspLEI	GCGC	2 cut(s)	688, 773
AspS9I	GGNCC	1 cut(s)	1091
AsuHPI	GGTGA	2 cut(s)	215, 430
AvaI	CYCGRG	1 cut(s)	259
AvaII	GGWCC	1 cut(s)	1091
BaeGI	GKGCMC	1 cut(s)	797
BamHI	GGATCC	1 cut(s)	746
BbsI	GAAGAC	2 cut(s)	721, 1211
Bbv12I	GWGCWC	2 cut(s)	622, 797
BbvI	GCAGC	5 cut(s)	90, 302, 643, 1144, 1163
BccI	CCATC	5 cut(s)	225, 607, 869, 1016, 1175
BceAI	ACGGC	1 cut(s)	338
BciT130I	CCWGG	1 cut(s)	1095
BcoDI	GTCTC	2 cut(s)	170, 1123
BcuI	ACTAGT	1 cut(s)	52
BfaI	CTAG	4 cut(s)	53, 774, 1050, 1267
BfoI	RGCGCY	1 cut(s)	774
BisI	GCNGC	5 cut(s)	79, 316, 657, 1133, 1152
BlpI	GCTNAGC	1 cut(s)	365
BlsI	GCNGC	5 cut(s)	80, 317, 658, 1134, 1153
Bme1390I	CCNGG	1 cut(s)	1095
Bme18I	GGWCC	1 cut(s)	1091
BmeT110I	CYCGRG	1 cut(s)	259
BmgT120I	GGNCC	1 cut(s)	1091
BmiI	GGNNCC	3 cut(s)	133, 748, 859
BmrFI	CCNGG	1 cut(s)	1095
BmsI	GCATC	2 cut(s)	340, 876
BpiI	GAAGAC	2 cut(s)	721, 1211
BpmI	CTGGAG	2 cut(s)	666, 1057
Bpu10I	CCTNAGC	1 cut(s)	360
Bpu1102I	GCTNAGC	1 cut(s)	365
Bsa29I	ATCGAT	1 cut(s)	884
BsaI	GGTCTC	2 cut(s)	170, 1123
BsaJI	CCNNGG	2 cut(s)	39, 709
BsaXI	ACNNNNNCTCC	2 cut(s)	1067, 1097
Bsc4I	CCNNNNNNNGG	4 cut(s)	486, 605, 824, 842
Bse1I	ACTGG	4 cut(s)	133, 523, 818, 1040
BseBI	CCWGG	1 cut(s)	1095
BseCI	ATCGAT	1 cut(s)	884
BseDI	CCNNGG	2 cut(s)	39, 709
BseGI	GGATG	3 cut(s)	674, 1171, 1192
BseLI	CCNNNNNNNGG	4 cut(s)	486, 605, 824, 842
BseMII	CTCAG	2 cut(s)	351, 411
BseNI	ACTGG	4 cut(s)	133, 523, 818, 1040
BseSI	GKGCMC	1 cut(s)	797
BseXI	GCAGC	5 cut(s)	90, 302, 643, 1144, 1163
BsgI	GTGCAG	1 cut(s)	301
Bsh1285I	CGRYCG	1 cut(s)	709
BshFI	GGCC	2 cut(s)	500, 522
BshVI	ATCGAT	1 cut(s)	884
BsiEI	CGRYCG	1 cut(s)	709
BsiHKAI	GWGCWC	2 cut(s)	622, 797
BsiHKCI	CYCGRG	1 cut(s)	259
BslI	CCNNNNNNNGG	4 cut(s)	486, 605, 824, 842
BsmAI	GTCTC	2 cut(s)	170, 1123
BsnI	GGCC	2 cut(s)	500, 522
Bso31I	GGTCTC	2 cut(s)	170, 1123
BsoBI	CYCGRG	1 cut(s)	259
Bsp1286I	GDGCHC	2 cut(s)	622, 797
Bsp143I	GATC	5 cut(s)	136, 649, 746, 776, 1054
Bsp1720I	GCTNAGC	1 cut(s)	365
BspACI	CCGC	2 cut(s)	76, 593
BspANI	GGCC	2 cut(s)	500, 522
BspCNI	CTCAG	2 cut(s)	352, 410
BspDI	ATCGAT	1 cut(s)	884
BspHI	TCATGA	1 cut(s)	1222
BspLI	GGNNCC	3 cut(s)	133, 748, 859
BspPI	GGATC	2 cut(s)	741, 754
BspQI	GCTCTTC	1 cut(s)	535
BspTNI	GGTCTC	2 cut(s)	170, 1123
BsrI	ACTGG	4 cut(s)	133, 523, 818, 1040
BssECI	CCNNGG	2 cut(s)	39, 709
BssMI	GATC	5 cut(s)	136, 649, 746, 776, 1054
BssT1I	CCWWGG	1 cut(s)	39
Bst2UI	CCWGG	1 cut(s)	1095
Bst4CI	ACNGT	5 cut(s)	193, 301, 424, 710, 979
Bst6I	CTCTTC	2 cut(s)	535, 1217
BstAPI	GCANNNNNTGC	2 cut(s)	350, 886
BstDEI	CTNAG	3 cut(s)	360, 365, 397
BstDSI	CCRYGG	1 cut(s)	709
BstF5I	GGATG	3 cut(s)	674, 1171, 1192
BstH2I	RGCGCY	1 cut(s)	774
BstHHI	GCGC	2 cut(s)	688, 773
BstKTI	GATC	5 cut(s)	139, 652, 749, 779, 1057
BstMAI	GTCTC	2 cut(s)	170, 1123
BstMBI	GATC	5 cut(s)	136, 649, 746, 776, 1054
BstMCI	CGRYCG	1 cut(s)	709
BstMWI	GCNNNNNNNGC	5 cut(s)	312, 350, 866, 886, 965
BstNI	CCWGG	1 cut(s)	1095
BstNSI	RCATGY	1 cut(s)	1003
BstSCI	CCNGG	1 cut(s)	1093
BstSLI	GKGCMC	1 cut(s)	797
BstV1I	GCAGC	5 cut(s)	90, 302, 643, 1144, 1163
BstV2I	GAAGAC	2 cut(s)	721, 1211
BstX2I	RGATCY	1 cut(s)	746
BstYI	RGATCY	1 cut(s)	746
Bsu15I	ATCGAT	1 cut(s)	884
BsuRI	GGCC	2 cut(s)	500, 522
BsuTUI	ATCGAT	1 cut(s)	884
BtgI	CCRYGG	1 cut(s)	709
BtsCI	GGATG	3 cut(s)	674, 1171, 1192
BtsI	GCAGTG	3 cut(s)	474, 558, 633
BtsIMutI	CAGTG	6 cut(s)	474, 558, 633, 825, 836, 975
CciI	TCATGA	1 cut(s)	1222
CfoI	GCGC	2 cut(s)	688, 773
Cfr13I	GGNCC	1 cut(s)	1091
ClaI	ATCGAT	1 cut(s)	884
Csp6I	GTAC	4 cut(s)	402, 516, 997, 1078
CviAII	CATG	3 cut(s)	145, 1000, 1223
CviQI	GTAC	4 cut(s)	402, 516, 997, 1078
DdeI	CTNAG	3 cut(s)	360, 365, 397
DpnI	GATC	5 cut(s)	138, 651, 748, 778, 1056
DpnII	GATC	5 cut(s)	136, 649, 746, 776, 1054
DrdI	GACNNNNNNGTC	1 cut(s)	184
DseDI	GACNNNNNNGTC	1 cut(s)	184
EaeI	YGGCCR	2 cut(s)	498, 520
Eam1104I	CTCTTC	2 cut(s)	535, 1217
EarI	CTCTTC	2 cut(s)	535, 1217
EciI	GGCGGA	1 cut(s)	582
Eco130I	CCWWGG	1 cut(s)	39
Eco31I	GGTCTC	2 cut(s)	170, 1123
Eco47I	GGWCC	1 cut(s)	1091
Eco47III	AGCGCT	1 cut(s)	772
Eco57I	CTGAAG	4 cut(s)	516, 1002, 1167, 1198
Eco88I	CYCGRG	1 cut(s)	259
EcoRII	CCWGG	1 cut(s)	1093
EcoT14I	CCWWGG	1 cut(s)	39
ErhI	CCWWGG	1 cut(s)	39
FaeI	CATG	3 cut(s)	148, 1003, 1226
FatI	CATG	3 cut(s)	144, 999, 1222
FauNDI	CATATG	1 cut(s)	1236
Fnu4HI	GCNGC	5 cut(s)	79, 316, 657, 1133, 1152
FokI	GGATG	3 cut(s)	681, 1178, 1199
Fsp4HI	GCNGC	5 cut(s)	79, 316, 657, 1133, 1152
FspBI	CTAG	4 cut(s)	53, 774, 1050, 1267
GlaI	GCGC	2 cut(s)	687, 772
GluI	GCNGC	5 cut(s)	79, 316, 657, 1133, 1152
GsuI	CTGGAG	2 cut(s)	666, 1057
HaeII	RGCGCY	1 cut(s)	774
HaeIII	GGCC	2 cut(s)	500, 522
HhaI	GCGC	2 cut(s)	688, 773
Hin1II	CATG	3 cut(s)	148, 1003, 1226
Hin6I	GCGC	2 cut(s)	686, 771
HinP1I	GCGC	2 cut(s)	686, 771
HincII	GTYRAC	1 cut(s)	189
HindII	GTYRAC	1 cut(s)	189
HinfI	GANTC	4 cut(s)	395, 494, 832, 1142
HphI	GGTGA	2 cut(s)	215, 430
Hpy166II	GTNNAC	3 cut(s)	189, 795, 1254
Hpy188I	TCNGA	7 cut(s)	136, 274, 767, 1006, 1021, 1059, 1147
Hpy188III	TCNNGA	5 cut(s)	210, 359, 645, 1050, 1223
Hpy8I	GTNNAC	3 cut(s)	189, 795, 1254
Hpy99I	CGWCG	1 cut(s)	248
HpyAV	CCTTC	3 cut(s)	409, 870, 1056
HpyCH4III	ACNGT	5 cut(s)	193, 301, 424, 710, 979
HpyCH4IV	ACGT	2 cut(s)	995, 1008
HpyF10VI	GCNNNNNNNGC	5 cut(s)	312, 350, 866, 886, 965
HpyF3I	CTNAG	3 cut(s)	360, 365, 397
HpySE526I	ACGT	2 cut(s)	995, 1008
Hsp92II	CATG	3 cut(s)	148, 1003, 1226
HspAI	GCGC	2 cut(s)	686, 771
Kzo9I	GATC	5 cut(s)	136, 649, 746, 776, 1054
LguI	GCTCTTC	1 cut(s)	535
LmnI	GCTCC	8 cut(s)	137, 553, 595, 617, 857, 892, 965, 1097
Lsp1109I	GCAGC	5 cut(s)	90, 302, 643, 1144, 1163
LweI	GCATC	2 cut(s)	340, 876
MaeI	CTAG	4 cut(s)	53, 774, 1050, 1267
MaeII	ACGT	2 cut(s)	995, 1008
MaeIII	GTNAC	3 cut(s)	285, 418, 1040
MalI	GATC	5 cut(s)	138, 651, 748, 778, 1056
MboI	GATC	5 cut(s)	136, 649, 746, 776, 1054
MboII	GAAGA	7 cut(s)	13, 498, 522, 726, 1204, 1211, 1238
MflI	RGATCY	1 cut(s)	746
MhlI	GDGCHC	2 cut(s)	622, 797
MluCI	AATT	8 cut(s)	275, 442, 502, 553, 612, 802, 916, 1243
MlyI	GAGTC	2 cut(s)	389, 488
MmeI	TCCRAC	2 cut(s)	138, 1007
MnlI	CCTC	5 cut(s)	106, 225, 255, 781, 923
MroXI	GAANNNNTTC	1 cut(s)	529
MseI	TTAA	6 cut(s)	278, 308, 426, 471, 579, 801
MspR9I	CCNGG	1 cut(s)	1095
MvaI	CCWGG	1 cut(s)	1095
MwoI	GCNNNNNNNGC	5 cut(s)	312, 350, 866, 886, 965
NdeI	CATATG	1 cut(s)	1236
NdeII	GATC	5 cut(s)	136, 649, 746, 776, 1054
NlaIII	CATG	3 cut(s)	148, 1003, 1226
NlaIV	GGNNCC	3 cut(s)	133, 748, 859
NmeAIII	GCCGAG	1 cut(s)	476
NmuCI	GTSAC	3 cut(s)	285, 418, 1040
NspI	RCATGY	1 cut(s)	1003
PaeR7I	CTCGAG	1 cut(s)	259
PagI	TCATGA	1 cut(s)	1222
PciI	ACATGT	1 cut(s)	999
PciSI	GCTCTTC	1 cut(s)	535
PdmI	GAANNNNTTC	1 cut(s)	529
PfeI	GAWTC	2 cut(s)	832, 1142
PflMI	CCANNNNNTGG	1 cut(s)	486
PkrI	GCNGC	5 cut(s)	80, 317, 658, 1134, 1153
PleI	GAGTC	2 cut(s)	389, 488
PpsI	GAGTC	2 cut(s)	389, 488
PscI	ACATGT	1 cut(s)	999
PshBI	ATTAAT	1 cut(s)	801
Psp6I	CCWGG	1 cut(s)	1093
PspGI	CCWGG	1 cut(s)	1093
PspN4I	GGNNCC	3 cut(s)	133, 748, 859
PspPI	GGNCC	1 cut(s)	1091
PspXI	VCTCGAGB	1 cut(s)	259
PsrI	GAACNNNNNNTAC	2 cut(s)	339, 371
PsuI	RGATCY	1 cut(s)	746
RsaI	GTAC	4 cut(s)	403, 517, 998, 1079
RsaNI	GTAC	4 cut(s)	402, 516, 997, 1078
SapI	GCTCTTC	1 cut(s)	535
SaqAI	TTAA	6 cut(s)	278, 308, 426, 471, 579, 801
SatI	GCNGC	5 cut(s)	79, 316, 657, 1133, 1152
Sau3AI	GATC	5 cut(s)	136, 649, 746, 776, 1054
Sau96I	GGNCC	1 cut(s)	1091
SchI	GAGTC	2 cut(s)	389, 488
ScrFI	CCNGG	1 cut(s)	1095
SduI	GDGCHC	2 cut(s)	622, 797
SfaNI	GCATC	2 cut(s)	340, 876
Sfr274I	CTCGAG	1 cut(s)	259
SinI	GGWCC	1 cut(s)	1091
SlaI	CTCGAG	1 cut(s)	259
SmlI	CTYRAG	1 cut(s)	259
SmoI	CTYRAG	1 cut(s)	259
SpeI	ACTAGT	1 cut(s)	52
Sse9I	AATT	8 cut(s)	275, 442, 502, 553, 612, 802, 916, 1243
SsiI	CCGC	2 cut(s)	76, 593
SspMI	CTAG	4 cut(s)	53, 774, 1050, 1267
StyD4I	CCNGG	1 cut(s)	1093
StyI	CCWWGG	1 cut(s)	39
TaaI	ACNGT	5 cut(s)	193, 301, 424, 710, 979
TaiI	ACGT	2 cut(s)	998, 1011
TaqI	TCGA	5 cut(s)	260, 393, 637, 884, 955
TasI	AATT	8 cut(s)	275, 442, 502, 553, 612, 802, 916, 1243
TfiI	GAWTC	2 cut(s)	832, 1142
Tru1I	TTAA	6 cut(s)	278, 308, 426, 471, 579, 801
Tru9I	TTAA	6 cut(s)	278, 308, 426, 471, 579, 801
TscAI	CASTG	6 cut(s)	481, 565, 633, 825, 843, 982
TseFI	GTSAC	3 cut(s)	285, 418, 1040
TseI	GCWGC	5 cut(s)	78, 315, 656, 1132, 1151
Tsp45I	GTSAC	3 cut(s)	285, 418, 1040
TspDTI	ATGAA	5 cut(s)	727, 748, 1203, 1211, 1239
TspRI	CASTG	6 cut(s)	481, 565, 633, 825, 843, 982
Van91I	CCANNNNNTGG	1 cut(s)	486
VneI	GTGCAC	1 cut(s)	793
VpaK11BI	GGWCC	1 cut(s)	1091
VspI	ATTAAT	1 cut(s)	801
XbaI	TCTAGA	1 cut(s)	1049
XceI	RCATGY	1 cut(s)	1003
XhoI	CTCGAG	1 cut(s)	259
XmnI	GAANNNNTTC	1 cut(s)	529
XspI	CTAG	4 cut(s)	53, 774, 1050, 1267

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.