Rmu_sc0010489.1_g000007

Ras-related protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010489.1
Physical Location & Seq
Forward (+)
28821 .. 30692
1872 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010489.1_g000007.1.cds

Sequence Viewer

Length: 675 bp
atgtcgaatttgcagagtagtttcaatcagaagatcgactacgtgttcaaggtggtgttgatcggagactcggcggtgggtaagtctcagctcttggctcgctttgctcggaatgagttcagtttggagtccaaagcaaccattggggttgagttccagaccaagacgcttctgatcgaccacaaaaccatcaaggcccagatttgggatactgctggccaagaaagatacagggctgtgacaagtgcatactataggggttcagtgggggcaatgctggtctatgacattacgaagcctcagtcatttgatcatgtaacgaggtggttagaggaactgaggggacatgctgacagcaatattgtcgtcatgcttgttggtaacaaatctgacctggggacgctgcgagctgtaccatctgaggatgcaaaagattttgcccagagggagaacctcttctttatggaggcatcagctcttgaagctactaatgttgaatctgcatttgtcacagtcctaacagaaatttatcgagtagttggcaagaagtccctcattgccaatgatgaaacagagtctggagggaattcctcacttctcaagggaactacacttattgtccctacacaagatcctctgcctgaagcaaaatctggctgttgcttctcttcatag

Protein Analysis

224

Amino Acids

24.66

Weight (kDa)

5.7

Isoelectric Point (pI)

34.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 74
AclWI GGATC 1 cut(s) 626
AcoI YGGCCR 1 cut(s) 217
AcsI RAATTY 3 cut(s) 7, 525, 586
AcuI CTGAAG 1 cut(s) 663
AfaI GTAC 1 cut(s) 414
AfiI CCNNNNNNNGG 2 cut(s) 204, 205
AflIII ACRYGT 1 cut(s) 42
AgsI TTSAA 4 cut(s) 25, 49, 482, 497
AjnI CCWGG 1 cut(s) 393
AluBI AGCT 4 cut(s) 91, 410, 476, 485
AluI AGCT 4 cut(s) 91, 410, 476, 485
Alw26I GTCTC 2 cut(s) 60, 90
AlwI GGATC 1 cut(s) 626
AlwNI CAGNNNCTG 1 cut(s) 578
AoxI GGCC 2 cut(s) 195, 217
ApeKI GCWGC 1 cut(s) 403
ApoI RAATTY 3 cut(s) 7, 525, 586
ArsI GACNNNNNNTTYG 2 cut(s) 287, 319
Asp700I GAANNNNTTC 2 cut(s) 116, 455
AspS9I GGNCC 1 cut(s) 196
BalI TGGCCA 1 cut(s) 219
BarI GAAGNNNNNNTAC 2 cut(s) 23, 55
BbvI GCAGC 1 cut(s) 390
BccI CCATC 2 cut(s) 197, 424
BcgI CGANNNNNNTGC 2 cut(s) 346, 380
BciT130I CCWGG 1 cut(s) 395
BciVI GTATCC 1 cut(s) 202
BclI TGATCA 1 cut(s) 310
BcoDI GTCTC 2 cut(s) 60, 90
BfmI CTRYAG 1 cut(s) 253
BfuI GTATCC 1 cut(s) 202
BisI GCNGC 1 cut(s) 404
BlsI GCNGC 1 cut(s) 405
Bme1390I CCNGG 1 cut(s) 395
BmgT120I GGNCC 1 cut(s) 196
BmrFI CCNGG 1 cut(s) 395
BmsI GCATC 2 cut(s) 415, 479
BpmI CTGGAG 1 cut(s) 600
BpuEI CTTGAG 1 cut(s) 584
BsaAI YACGTR 1 cut(s) 43
BsaJI CCNNGG 1 cut(s) 394
Bsc4I CCNNNNNNNGG 2 cut(s) 204, 205
Bse3DI GCAATG 2 cut(s) 279, 555
BseBI CCWGG 1 cut(s) 395
BseDI CCNNGG 1 cut(s) 394
BseGI GGATG 1 cut(s) 430
BseLI CCNNNNNNNGG 2 cut(s) 204, 205
BseMI GCAATG 2 cut(s) 279, 555
BseMII CTCAG 4 cut(s) 101, 314, 329, 411
BseXI GCAGC 1 cut(s) 390
BshFI GGCC 2 cut(s) 197, 219
BslFI GGGAC 4 cut(s) 357, 412, 535, 605
BslI CCNNNNNNNGG 2 cut(s) 204, 205
BsmAI GTCTC 2 cut(s) 60, 90
BsmFI GGGAC 4 cut(s) 357, 412, 535, 605
BsnI GGCC 2 cut(s) 197, 219
Bsp143I GATC 5 cut(s) 33, 60, 174, 310, 631
BspACI CCGC 1 cut(s) 74
BspANI GGCC 2 cut(s) 197, 219
BspCNI CTCAG 4 cut(s) 100, 313, 330, 412
BspPI GGATC 1 cut(s) 626
BsrDI GCAATG 2 cut(s) 279, 555
BssECI CCNNGG 1 cut(s) 394
BssMI GATC 5 cut(s) 33, 60, 174, 310, 631
Bst2UI CCWGG 1 cut(s) 395
Bst4CI ACNGT 1 cut(s) 514
Bst6I CTCTTC 1 cut(s) 461
BstBAI YACGTR 1 cut(s) 43
BstC8I GCNNGC 3 cut(s) 100, 217, 408
BstDEI CTNAG 4 cut(s) 87, 300, 338, 420
BstF5I GGATG 1 cut(s) 430
BstKTI GATC 5 cut(s) 36, 63, 177, 313, 634
BstMAI GTCTC 2 cut(s) 60, 90
BstMBI GATC 5 cut(s) 33, 60, 174, 310, 631
BstMWI GCNNNNNNNGC 2 cut(s) 104, 482
BstNI CCWGG 1 cut(s) 395
BstNSI RCATGY 1 cut(s) 350
BstSCI CCNGG 1 cut(s) 393
BstSFI CTRYAG 1 cut(s) 253
BstV1I GCAGC 1 cut(s) 390
BstX2I RGATCY 1 cut(s) 631
BstYI RGATCY 1 cut(s) 631
BsuI GTATCC 1 cut(s) 202
BsuRI GGCC 2 cut(s) 197, 219
BtsCI GGATG 1 cut(s) 430
BtsIMutI CAGTG 1 cut(s) 270
Cac8I GCNNGC 3 cut(s) 100, 217, 408
CaiI CAGNNNCTG 1 cut(s) 578
Cfr13I GGNCC 1 cut(s) 196
CseI GACGC 2 cut(s) 175, 409
Csp6I GTAC 1 cut(s) 413
CviAII CATG 3 cut(s) 314, 347, 370
CviQI GTAC 1 cut(s) 413
DdeI CTNAG 4 cut(s) 87, 300, 338, 420
DpnI GATC 5 cut(s) 35, 62, 176, 312, 633
DpnII GATC 5 cut(s) 33, 60, 174, 310, 631
EaeI YGGCCR 1 cut(s) 217
Eam1104I CTCTTC 1 cut(s) 461
EarI CTCTTC 1 cut(s) 461
Eco57I CTGAAG 1 cut(s) 663
EcoRI GAATTC 1 cut(s) 586
EcoRII CCWGG 1 cut(s) 393
FaeI CATG 3 cut(s) 317, 350, 373
FaiI YATR 8 cut(s) 250, 255, 285, 315, 348, 371, 464, 673
FaqI GGGAC 4 cut(s) 357, 412, 535, 605
FatI CATG 3 cut(s) 313, 346, 369
FbaI TGATCA 1 cut(s) 310
Fnu4HI GCNGC 1 cut(s) 404
FokI GGATG 1 cut(s) 437
Fsp4HI GCNGC 1 cut(s) 404
GluI GCNGC 1 cut(s) 404
GsuI CTGGAG 1 cut(s) 600
HaeIII GGCC 2 cut(s) 197, 219
HgaI GACGC 2 cut(s) 175, 409
Hin1II CATG 3 cut(s) 317, 350, 373
HinfI GANTC 4 cut(s) 68, 128, 497, 575
Hpy188I TCNGA 6 cut(s) 30, 65, 111, 174, 391, 421
Hpy188III TCNNGA 3 cut(s) 157, 479, 579
HpyCH4III ACNGT 1 cut(s) 514
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 4 cut(s) 13, 248, 428, 503
HpyF10VI GCNNNNNNNGC 2 cut(s) 104, 482
HpyF3I CTNAG 4 cut(s) 87, 300, 338, 420
HpySE526I ACGT 1 cut(s) 42
Hsp92II CATG 3 cut(s) 317, 350, 373
Ksp22I TGATCA 1 cut(s) 310
Kzo9I GATC 5 cut(s) 33, 60, 174, 310, 631
Lsp1109I GCAGC 1 cut(s) 390
LweI GCATC 2 cut(s) 415, 479
MaeII ACGT 1 cut(s) 42
MaeIII GTNAC 4 cut(s) 238, 316, 380, 508
MalI GATC 5 cut(s) 35, 62, 176, 312, 633
MboI GATC 5 cut(s) 33, 60, 174, 310, 631
MboII GAAGA 3 cut(s) 43, 448, 660
MflI RGATCY 1 cut(s) 631
MlsI TGGCCA 1 cut(s) 219
MluCI AATT 3 cut(s) 7, 525, 586
MluNI TGGCCA 1 cut(s) 219
MlyI GAGTC 3 cut(s) 62, 137, 584
Mox20I TGGCCA 1 cut(s) 219
MroXI GAANNNNTTC 2 cut(s) 116, 455
MscI TGGCCA 1 cut(s) 219
Msp20I TGGCCA 1 cut(s) 219
MspR9I CCNGG 1 cut(s) 395
MvaI CCWGG 1 cut(s) 395
MwoI GCNNNNNNNGC 2 cut(s) 104, 482
NdeII GATC 5 cut(s) 33, 60, 174, 310, 631
NlaIII CATG 3 cut(s) 317, 350, 373
NmeAIII GCCGAG 1 cut(s) 50
NmuCI GTSAC 2 cut(s) 238, 508
NspI RCATGY 1 cut(s) 350
PdmI GAANNNNTTC 2 cut(s) 116, 455
PfeI GAWTC 1 cut(s) 497
PkrI GCNGC 1 cut(s) 405
PleI GAGTC 3 cut(s) 62, 136, 583
PpsI GAGTC 3 cut(s) 62, 136, 583
Ppu21I YACGTR 1 cut(s) 43
Psp6I CCWGG 1 cut(s) 393
PspGI CCWGG 1 cut(s) 393
PspPI GGNCC 1 cut(s) 196
PstNI CAGNNNCTG 1 cut(s) 578
PsuI RGATCY 1 cut(s) 631
RsaI GTAC 1 cut(s) 414
RsaNI GTAC 1 cut(s) 413
SatI GCNGC 1 cut(s) 404
Sau3AI GATC 5 cut(s) 33, 60, 174, 310, 631
Sau96I GGNCC 1 cut(s) 196
SchI GAGTC 3 cut(s) 62, 137, 584
ScrFI CCNGG 1 cut(s) 395
SetI ASST 9 cut(s) 45, 54, 93, 326, 396, 412, 456, 478, 487
SfaNI GCATC 2 cut(s) 415, 479
SfcI CTRYAG 1 cut(s) 253
SmlI CTYRAG 1 cut(s) 599
SmoI CTYRAG 1 cut(s) 599
Sse9I AATT 3 cut(s) 7, 525, 586
SsiI CCGC 1 cut(s) 74
SspI AATATT 1 cut(s) 361
StyD4I CCNGG 1 cut(s) 393
TaaI ACNGT 1 cut(s) 514
TaiI ACGT 1 cut(s) 45
TaqI TCGA 4 cut(s) 5, 36, 177, 532
TasI AATT 3 cut(s) 7, 525, 586
TfiI GAWTC 1 cut(s) 497
TscAI CASTG 1 cut(s) 270
TseFI GTSAC 2 cut(s) 238, 508
TseI GCWGC 1 cut(s) 403
Tsp45I GTSAC 2 cut(s) 238, 508
TspDTI ATGAA 2 cut(s) 582, 660
TspRI CASTG 1 cut(s) 270
XapI RAATTY 3 cut(s) 7, 525, 586
XceI RCATGY 1 cut(s) 350
XmnI GAANNNNTTC 2 cut(s) 116, 455
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.