Rmu_sc0010513.1_g000008

Pistil-specific extensin-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010513.1
Physical Location & Seq
Forward (+)
33971 .. 35210
1240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010513.1_g000008.1.cds

Sequence Viewer

Length: 522 bp
atggcgattctgaaatatgcagtagtactactgatgattgtattgggttgcatccataatacagtagaagcttcgtttagtgaggaaccaaaagtcatacgtgtagatgggaaagtactatgccaggactgcacccaaggttggaatgaatggattcatggtgccagacccatcaaaggtggtaaagtatctgttacgtgtatggatgagagaagaagagttgtgtactatggaagcgatttgacggatgagatgggccagttcgacttgaccataaacaagtacactatccatggtaaagaactccaggctaatggatgctcggtgaggttggtgtcttccccagatgctacttgtaacgttctaactgattttgccggtgggcgttccggggttaagctccaacgcccgaatttggtgtaccgggatttggtcaagtacactcttggtccgttctactataccactccaatgtgtgaagaacctgatactcatgatgatggcaagggacacaactactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

19.36

Weight (kDa)

6.19

Isoelectric Point (pI)

38.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015362)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 161
AclI AACGTT 1 cut(s) 360
AcsI RAATTY 1 cut(s) 412
AfaI GTAC 6 cut(s) 27, 117, 227, 284, 422, 440
AfiI CCNNNNNNNGG 4 cut(s) 141, 176, 415, 430
AflIII ACRYGT 2 cut(s) 100, 197
AjnI CCWGG 2 cut(s) 123, 306
AluBI AGCT 2 cut(s) 71, 400
AluI AGCT 2 cut(s) 71, 400
AoxI GGCC 1 cut(s) 256
ApoI RAATTY 1 cut(s) 412
Asp700I GAANNNNTTC 1 cut(s) 153
AspS9I GGNCC 2 cut(s) 256, 449
AsuC2I CCSGG 2 cut(s) 391, 425
AsuHPI GGTGA 1 cut(s) 337
AvaII GGWCC 1 cut(s) 449
BanI GGYRCC 1 cut(s) 161
BbsI GAAGAC 1 cut(s) 330
BccI CCATC 4 cut(s) 101, 179, 247, 494
BciT130I CCWGG 2 cut(s) 125, 308
BcnI CCSGG 2 cut(s) 391, 425
BmcAI AGTACT 2 cut(s) 27, 117
Bme1390I CCNGG 4 cut(s) 125, 308, 391, 425
Bme18I GGWCC 1 cut(s) 449
BmgT120I GGNCC 2 cut(s) 256, 449
BmiI GGNNCC 2 cut(s) 87, 163
BmrFI CCNGG 4 cut(s) 125, 308, 391, 425
BmsI GCATC 3 cut(s) 60, 308, 337
BpiI GAAGAC 1 cut(s) 330
BpmI CTGGAG 1 cut(s) 290
BpuMI CCSGG 2 cut(s) 391, 425
BsaAI YACGTR 2 cut(s) 101, 198
BsaJI CCNNGG 3 cut(s) 136, 292, 390
Bsc4I CCNNNNNNNGG 4 cut(s) 141, 176, 415, 430
Bse118I RCCGGY 1 cut(s) 377
Bse1I ACTGG 1 cut(s) 259
BseBI CCWGG 2 cut(s) 125, 308
BseDI CCNNGG 3 cut(s) 136, 292, 390
BseGI GGATG 4 cut(s) 51, 211, 253, 323
BseLI CCNNNNNNNGG 4 cut(s) 141, 176, 415, 430
BseNI ACTGG 1 cut(s) 259
BsgI GTGCAG 1 cut(s) 115
BshFI GGCC 1 cut(s) 258
BshNI GGYRCC 1 cut(s) 161
BsiSI CCGG 3 cut(s) 378, 390, 424
BslI CCNNNNNNNGG 4 cut(s) 141, 176, 415, 430
BsnI GGCC 1 cut(s) 258
Bsp19I CCATGG 1 cut(s) 292
BspANI GGCC 1 cut(s) 258
BspHI TCATGA 1 cut(s) 493
BspLI GGNNCC 2 cut(s) 87, 163
BspT107I GGYRCC 1 cut(s) 161
BsrFI RCCGGY 1 cut(s) 377
BsrI ACTGG 1 cut(s) 259
BssAI RCCGGY 1 cut(s) 377
BssECI CCNNGG 3 cut(s) 136, 292, 390
BssT1I CCWWGG 2 cut(s) 136, 292
Bst2UI CCWGG 2 cut(s) 125, 308
Bst4CI ACNGT 1 cut(s) 64
Bst6I CTCTTC 1 cut(s) 211
BstBAI YACGTR 2 cut(s) 101, 198
BstDSI CCRYGG 1 cut(s) 292
BstF5I GGATG 4 cut(s) 51, 211, 253, 323
BstMWI GCNNNNNNNGC 1 cut(s) 129
BstNI CCWGG 2 cut(s) 125, 308
BstSCI CCNGG 4 cut(s) 123, 306, 389, 423
BstV2I GAAGAC 1 cut(s) 330
BstXI CCANNNNNNTGG 1 cut(s) 314
BsuRI GGCC 1 cut(s) 258
BtgI CCRYGG 1 cut(s) 292
BtsCI GGATG 4 cut(s) 51, 211, 253, 323
CciI TCATGA 1 cut(s) 493
Cfr10I RCCGGY 1 cut(s) 377
Cfr13I GGNCC 2 cut(s) 256, 449
Csp6I GTAC 6 cut(s) 26, 116, 226, 283, 421, 439
CviAII CATG 3 cut(s) 158, 293, 494
CviJI RGCY 4 cut(s) 71, 258, 311, 400
CviKI_1 RGCY 4 cut(s) 71, 258, 311, 400
CviQI GTAC 6 cut(s) 26, 116, 226, 283, 421, 439
Eam1104I CTCTTC 1 cut(s) 211
EarI CTCTTC 1 cut(s) 211
Eco130I CCWWGG 2 cut(s) 136, 292
Eco47I GGWCC 1 cut(s) 449
EcoRII CCWGG 2 cut(s) 123, 306
EcoT14I CCWWGG 2 cut(s) 136, 292
ErhI CCWWGG 2 cut(s) 136, 292
FaeI CATG 3 cut(s) 161, 296, 497
FatI CATG 3 cut(s) 157, 292, 493
FokI GGATG 4 cut(s) 38, 218, 260, 330
GsuI CTGGAG 1 cut(s) 290
HaeIII GGCC 1 cut(s) 258
HapII CCGG 3 cut(s) 378, 390, 424
Hin1II CATG 3 cut(s) 161, 296, 497
HindIII AAGCTT 1 cut(s) 69
HinfI GANTC 2 cut(s) 7, 154
HpaII CCGG 3 cut(s) 378, 390, 424
HphI GGTGA 1 cut(s) 337
Hpy166II GTNNAC 4 cut(s) 226, 285, 421, 441
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 494
Hpy8I GTNNAC 4 cut(s) 226, 285, 421, 441
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4IV ACGT 3 cut(s) 100, 197, 360
HpyCH4V TGCA 3 cut(s) 20, 51, 132
HpyF10VI GCNNNNNNNGC 1 cut(s) 129
HpySE526I ACGT 3 cut(s) 100, 197, 360
Hsp92II CATG 3 cut(s) 161, 296, 497
LmnI GCTCC 1 cut(s) 405
LweI GCATC 3 cut(s) 60, 308, 337
MaeII ACGT 3 cut(s) 100, 197, 360
MaeIII GTNAC 2 cut(s) 193, 356
MboII GAAGA 4 cut(s) 225, 228, 330, 491
MluCI AATT 1 cut(s) 412
MmeI TCCRAC 2 cut(s) 122, 427
MnlI CCTC 2 cut(s) 76, 321
MroXI GAANNNNTTC 1 cut(s) 153
MseI TTAA 1 cut(s) 396
MslI CAYNNNNRTG 2 cut(s) 470, 498
MspI CCGG 3 cut(s) 378, 390, 424
MspR9I CCNGG 4 cut(s) 125, 308, 391, 425
MvaI CCWGG 2 cut(s) 125, 308
MwoI GCNNNNNNNGC 1 cut(s) 129
NciI CCSGG 2 cut(s) 391, 425
NcoI CCATGG 1 cut(s) 292
NlaIII CATG 3 cut(s) 161, 296, 497
NlaIV GGNNCC 2 cut(s) 87, 163
PagI TCATGA 1 cut(s) 493
PdmI GAANNNNTTC 1 cut(s) 153
PfeI GAWTC 2 cut(s) 7, 154
Ppu21I YACGTR 2 cut(s) 101, 198
Psp1406I AACGTT 1 cut(s) 360
Psp6I CCWGG 2 cut(s) 123, 306
PspGI CCWGG 2 cut(s) 123, 306
PspN4I GGNNCC 2 cut(s) 87, 163
PspPI GGNCC 2 cut(s) 256, 449
RsaI GTAC 6 cut(s) 27, 117, 227, 284, 422, 440
RsaNI GTAC 6 cut(s) 26, 116, 226, 283, 421, 439
RseI CAYNNNNRTG 2 cut(s) 470, 498
SaqAI TTAA 1 cut(s) 396
Sau96I GGNCC 2 cut(s) 256, 449
ScaI AGTACT 2 cut(s) 27, 117
ScrFI CCNGG 4 cut(s) 125, 308, 391, 425
SetI ASST 9 cut(s) 73, 103, 142, 181, 200, 332, 363, 402, 487
SfaNI GCATC 3 cut(s) 60, 308, 337
SinI GGWCC 1 cut(s) 449
SmiMI CAYNNNNRTG 2 cut(s) 470, 498
Sse9I AATT 1 cut(s) 412
StyD4I CCNGG 4 cut(s) 123, 306, 389, 423
StyI CCWWGG 2 cut(s) 136, 292
TaaI ACNGT 1 cut(s) 64
TaiI ACGT 3 cut(s) 103, 200, 363
TaqI TCGA 1 cut(s) 264
TasI AATT 1 cut(s) 412
TatI WGTACW 5 cut(s) 25, 115, 225, 282, 438
TfiI GAWTC 2 cut(s) 7, 154
Tru1I TTAA 1 cut(s) 396
Tru9I TTAA 1 cut(s) 396
TspDTI ATGAA 2 cut(s) 146, 162
TspGWI ACGGA 2 cut(s) 260, 441
VpaK11BI GGWCC 1 cut(s) 449
XapI RAATTY 1 cut(s) 412
XmnI GAANNNNTTC 1 cut(s) 153
ZrmI AGTACT 2 cut(s) 27, 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.