Rmu_sc0011073.1_g000005

Belongs to the acylphosphatase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011073.1
Physical Location & Seq
Forward (+)
44496 .. 45067
572 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011073.1_g000005.1.cds

Sequence Viewer

Length: 318 bp
atgaccaccacacaggccgcctccgaatccccccaatcctccaccaaaacggtgaggcttgtgataaaagggagggttcagggtgtgttttacaggaactggactatagagaatgcaacccaattggggttgaagggttgggtgaggaacaggagagatgggtctgtggagactctgctatctgggaattccgatgcggtccaggaaatggagcagaggtgtcgacgaggtcctccatctgcaatggtcactgggcttgaggttaatcccagcactgatgaccctggttctggatttgagcgcaaacaaacggtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.54

Weight (kDa)

9.5

Isoelectric Point (pI)

45.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015379)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G03370
fragaria_vesca FvH4_6g16390
malus_domestica MD04G1093600.v1.1
prunus_persica Prupe.6G232200_v2.0.a1
pyrus_communis pycom04g08880
rosa_chinensis RchiOBHm_Chr3g0470251
rosa_laevigata RLG00000024286
rosa_multiflora Rmu_co8326943.1_g000001 Rmu_sc0011073.1_g000005
rosa_roxburghii Rroxscaffold_6G00411030
rosa_rugosa Rorug03G0107700
rosa_samantha Rh3AG157300 Rh3BG181400 Rh3CG172300 Rh3DG193400
rosa_wichuraiana Rw3G014970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 208
AccI GTMKAC 1 cut(s) 223
AciI CCGC 2 cut(s) 18, 197
AcsI RAATTY 1 cut(s) 187
AfiI CCNNNNNNNGG 3 cut(s) 126, 208, 290
AgsI TTSAA 1 cut(s) 133
AjnI CCWGG 2 cut(s) 201, 283
Alw26I GTCTC 1 cut(s) 164
AlwNI CAGNNNCTG 1 cut(s) 99
AoxI GGCC 1 cut(s) 15
ApoI RAATTY 1 cut(s) 187
AspLEI GCGC 1 cut(s) 303
AspS9I GGNCC 2 cut(s) 199, 230
AsuHPI GGTGA 2 cut(s) 64, 154
AvaII GGWCC 2 cut(s) 199, 230
BccI CCATC 2 cut(s) 152, 244
BcgI CGANNNNNNTGC 2 cut(s) 203, 237
BciT130I CCWGG 2 cut(s) 203, 285
BcoDI GTCTC 1 cut(s) 164
BfmI CTRYAG 1 cut(s) 105
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
Bme1390I CCNGG 2 cut(s) 203, 285
Bme18I GGWCC 2 cut(s) 199, 230
BmgT120I GGNCC 2 cut(s) 199, 230
BmrFI CCNGG 2 cut(s) 203, 285
BmrI ACTGGG 1 cut(s) 261
BmsI GCATC 1 cut(s) 184
BmuI ACTGGG 1 cut(s) 261
BpuEI CTTGAG 1 cut(s) 278
BsaJI CCNNGG 1 cut(s) 283
BsaXI ACNNNNNCTCC 2 cut(s) 203, 233
Bsc4I CCNNNNNNNGG 3 cut(s) 126, 208, 290
Bse1I ACTGG 2 cut(s) 104, 256
Bse3DI GCAATG 1 cut(s) 249
BseBI CCWGG 2 cut(s) 203, 285
BseDI CCNNGG 1 cut(s) 283
BseLI CCNNNNNNNGG 3 cut(s) 126, 208, 290
BseMI GCAATG 1 cut(s) 249
BseNI ACTGG 2 cut(s) 104, 256
BseYI CCCAGC 1 cut(s) 269
BshFI GGCC 1 cut(s) 17
BslI CCNNNNNNNGG 3 cut(s) 126, 208, 290
BsmAI GTCTC 1 cut(s) 164
BsmI GAATGC 1 cut(s) 118
BsnI GGCC 1 cut(s) 17
BspACI CCGC 2 cut(s) 18, 197
BspANI GGCC 1 cut(s) 17
BsrDI GCAATG 1 cut(s) 249
BsrI ACTGG 2 cut(s) 104, 256
BssECI CCNNGG 1 cut(s) 283
Bst2UI CCWGG 2 cut(s) 203, 285
Bst4CI ACNGT 2 cut(s) 52, 313
BstHHI GCGC 1 cut(s) 303
BstMAI GTCTC 1 cut(s) 164
BstNI CCWGG 2 cut(s) 203, 285
BstSCI CCNGG 2 cut(s) 201, 283
BstSFI CTRYAG 1 cut(s) 105
BsuRI GGCC 1 cut(s) 17
BtsIMutI CAGTG 2 cut(s) 249, 273
CaiI CAGNNNCTG 1 cut(s) 99
CfoI GCGC 1 cut(s) 303
Cfr13I GGNCC 2 cut(s) 199, 230
CviJI RGCY 3 cut(s) 17, 58, 256
CviKI_1 RGCY 3 cut(s) 17, 58, 256
Eco47I GGWCC 2 cut(s) 199, 230
EcoO109I RGGNCCY 1 cut(s) 230
EcoRI GAATTC 1 cut(s) 187
EcoRII CCWGG 2 cut(s) 201, 283
FaiI YATR 1 cut(s) 107
FblI GTMKAC 1 cut(s) 223
Fnu4HI GCNGC 1 cut(s) 18
Fsp4HI GCNGC 1 cut(s) 18
GlaI GCGC 1 cut(s) 302
GluI GCNGC 1 cut(s) 18
GsaI CCCAGC 1 cut(s) 273
HaeIII GGCC 1 cut(s) 17
HhaI GCGC 1 cut(s) 303
Hin6I GCGC 1 cut(s) 301
HinP1I GCGC 1 cut(s) 301
HincII GTYRAC 1 cut(s) 224
HindII GTYRAC 1 cut(s) 224
HinfI GANTC 2 cut(s) 26, 172
HphI GGTGA 2 cut(s) 64, 154
Hpy166II GTNNAC 1 cut(s) 224
Hpy188I TCNGA 2 cut(s) 25, 193
Hpy188III TCNNGA 1 cut(s) 291
Hpy8I GTNNAC 1 cut(s) 224
Hpy99I CGWCG 1 cut(s) 228
HpyAV CCTTC 1 cut(s) 127
HpyCH4III ACNGT 2 cut(s) 52, 313
HpyCH4V TGCA 2 cut(s) 116, 242
HspAI GCGC 1 cut(s) 301
LmnI GCTCC 1 cut(s) 211
LweI GCATC 1 cut(s) 184
MaeIII GTNAC 1 cut(s) 247
MfeI CAATTG 1 cut(s) 122
MluCI AATT 2 cut(s) 122, 187
MlyI GAGTC 1 cut(s) 166
MnlI CCTC 9 cut(s) 31, 48, 49, 66, 138, 210, 221, 243, 253
MseI TTAA 1 cut(s) 264
MspR9I CCNGG 2 cut(s) 203, 285
MunI CAATTG 1 cut(s) 122
Mva1269I GAATGC 1 cut(s) 118
MvaI CCWGG 2 cut(s) 203, 285
NmuCI GTSAC 1 cut(s) 247
PctI GAATGC 1 cut(s) 118
PfeI GAWTC 1 cut(s) 26
PflFI GACNNNGTC 1 cut(s) 228
PflMI CCANNNNNTGG 1 cut(s) 208
PfoI TCCNGGA 1 cut(s) 201
PkrI GCNGC 1 cut(s) 19
PleI GAGTC 1 cut(s) 166
PpsI GAGTC 1 cut(s) 166
PpuMI RGGWCCY 1 cut(s) 230
Psp5II RGGWCCY 1 cut(s) 230
Psp6I CCWGG 2 cut(s) 201, 283
PspFI CCCAGC 1 cut(s) 269
PspGI CCWGG 2 cut(s) 201, 283
PspPI GGNCC 2 cut(s) 199, 230
PspPPI RGGWCCY 1 cut(s) 230
PstNI CAGNNNCTG 1 cut(s) 99
PsyI GACNNNGTC 1 cut(s) 228
SalI GTCGAC 1 cut(s) 222
SaqAI TTAA 1 cut(s) 264
SatI GCNGC 1 cut(s) 18
Sau96I GGNCC 2 cut(s) 199, 230
SchI GAGTC 1 cut(s) 166
ScrFI CCNGG 2 cut(s) 203, 285
SetI ASST 3 cut(s) 221, 232, 264
SfaNI GCATC 1 cut(s) 184
SfcI CTRYAG 1 cut(s) 105
SinI GGWCC 2 cut(s) 199, 230
SmlI CTYRAG 1 cut(s) 257
SmoI CTYRAG 1 cut(s) 257
Sse9I AATT 2 cut(s) 122, 187
SsiI CCGC 2 cut(s) 18, 197
StyD4I CCNGG 2 cut(s) 201, 283
TaaI ACNGT 2 cut(s) 52, 313
TaqI TCGA 1 cut(s) 223
TasI AATT 2 cut(s) 122, 187
TauI GCSGC 1 cut(s) 20
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 1 cut(s) 264
Tru9I TTAA 1 cut(s) 264
TscAI CASTG 2 cut(s) 256, 280
TseFI GTSAC 1 cut(s) 247
Tsp45I GTSAC 1 cut(s) 247
TspRI CASTG 2 cut(s) 256, 280
Tth111I GACNNNGTC 1 cut(s) 228
Van91I CCANNNNNTGG 1 cut(s) 208
VpaK11BI GGWCC 2 cut(s) 199, 230
XapI RAATTY 1 cut(s) 187
XmiI GTMKAC 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.