Rmu_sc0011781.1_g000003
BHLH Family

transcription factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011781.1
OG0012635
Physical Location & Seq
Forward (+)
15230 .. 20253
5024 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011781.1_g000003.1.cds

Sequence Viewer

Length: 2136 bp
atgaacaacaggagccacttcttcagttctagagaaattatgaacgccgaaactttggcggttgattcgcggattttgagctgggaggatgggtactgtcaccaaccaaaaccaagagaaactgtggatcgtgcaacagatagtatctactttggtgaggcgaatgagatatcttttaagaagtgtgcaacaggcatgcatgaaggtggatctgcggggtatccaattggactggcagtggctgatatgtcacatcttcattacacatttggaaagggggtagtcggtgaggttgcaagtacaggaaaccatagctgggtgctcctcgatggtttgcgcaccagcgtatctgactctaacttagtttcggattgtccagatgagtggttgcttcagtttgcattgggcgtcaagacaattttgcttgtacctgtacttccacacggagttttgcaatttggctccttggaaacggttgatgaagatctggcagtagttgcttttatgaaagacagattcaatgatattcacaatctcatggggaaagctgtaccttccaacttaaataggggcattcaagctccatattcttggtcacttttatctggtttaatggagaacacatatgagtcatcaactgttggcattaacccactgaaagttgaaacgtcagaagatattggcaacaacagacggaatgataacctactgtcgactttggagcaattcatgcaatttccaaccattgaagatccacattttggaatagatccatcagttcttaaaaatgcaggtgaatgtgagattggtgttccggcattttgttccactggagaagcaaatacagtcaatcagtctacacacactagtgtgctggatatggtggaaaatcagatatttgggttgtcttgtcaggaggaagaactttttgccttttctcagaatggtggttataattttggagtttttggagaatcctttggaggtttcaattctaacaccgctggaagtgcagcagaacaactgttcaaattcaataatgatacaaggcacaacagtgtgaataatttctttgaatttcctgaaactagtgagctacacaaagcacttggaacatctttccagagacaaaccaatgaacagttatgggatttatccatctccattgatgatacatgtagcagctctggtgtgcagaaagatcttattagcagcattaacccaccatggttttccaacggatgtgatgctgagaacctcttggaagcttcagtagccaaagatgacacatcatctagcatatcagatggtattaaatcatgtacaacctcatcaagacaattttctgcttcctataaacaattgaaatttgaagagggcggtccgatggaatgtgaaccaatgatatggagccatacatctgctttgcctgccacgcgcaagacttcatcttctttcacaggcatgatgaacactgtggttgacgatgagcaggaagaaaagggaacaaaaggacacactcctactcagcctaaaagggaacagaagttgtccggcaccaatgcaagaagggccaaacctggcaatagcccaaagctaagaccaagagatagacaactgattcaggatcgtgtcaaggaacttcgagaacttgtcccaaatggtgccaagtgcagcattgatggccttttggaccgaacaataaaacacatgatgtatttaagaagcatgactaaccaagctgaaaaattgaagtcctatgcacatcaagatcaagaggcacctcattgcaataacacaaatgagaccccaagtggctcctcaaatggcacaagcagggcttttgaacttggaaatgaactccagattagtcccattgtagtggaagatctcgaacacccagggcatatgctcatagagatggtatgtgatgaacacgggctctttcttgaaatcgcccaagctatcagacggttggagttaacagtgttgaagggtgtgatggaaacccgctcaaacaacttgtgggcacattttgttgttgaggctcccagaggatttcacagaatggatgtgttttggcctcttctacatctactgcaacgcagaagaggttccctatcaagcaagatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
bHLH-MYC_N

Protein Analysis

711

Amino Acids

78.79

Weight (kDa)

5.25

Isoelectric Point (pI)

38.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012635)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g13090 FvH4_6g13090 FvH4_6g13090 FvH4_6g13090 FvH4_6g13090
malus_domestica MD04G1135600.v1.1 MD12G1149300.v1.1
prunus_persica Prupe.6G260900_v2.0.a1
pyrus_communis pycom04g12270 pycom12g14310
rosa_chinensis RchiOBHm_Chr3g0465361
rosa_laevigata RLG00000024643
rosa_multiflora Rmu_sc0011781.1_g000003
rosa_roxburghii Rroxscaffold_6G00415100
rosa_rugosa Rorug03G0076300
rosa_samantha Rh3BG141300 Rh3CG142400 Rh3DG142400
rosa_wichuraiana Rw3G011560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 954
AarI CACCTGC 1 cut(s) 782
Acc16I TGCGCA 1 cut(s) 338
Acc36I ACCTGC 1 cut(s) 782
AccB1I GGYRCC 3 cut(s) 1556, 1664, 1780
AccB7I CCANNNNNTGG 1 cut(s) 761
AccBSI CCGCTC 1 cut(s) 2013
AccI GTMKAC 2 cut(s) 713, 857
AccII CGCG 2 cut(s) 70, 1438
AciI CCGC 6 cut(s) 59, 70, 215, 1002, 1380, 2011
AclWI GGATC 5 cut(s) 135, 217, 746, 764, 1635
AcsI RAATTY 3 cut(s) 1031, 1076, 1367
AcuI CTGAAG 3 cut(s) 7, 377, 1254
AcyI GRCGYC 1 cut(s) 408
AfaI GTAC 6 cut(s) 95, 301, 429, 435, 552, 1324
AfiI CCNNNNNNNGG 2 cut(s) 316, 761
AflIII ACRYGT 1 cut(s) 1175
AhlI ACTAGT 2 cut(s) 866, 1088
AjnI CCWGG 2 cut(s) 1579, 1900
AjuI GAANNNNNNNTTGG 2 cut(s) 789, 821
AleI CACNNNNGTG 3 cut(s) 867, 869, 1056
Alw21I GWGCWC 1 cut(s) 324
Alw26I GTCTC 2 cut(s) 1120, 1799
AlwI GGATC 5 cut(s) 135, 217, 746, 764, 1635
AlwNI CAGNNNCTG 1 cut(s) 242
AoxI GGCC 3 cut(s) 1572, 1684, 2081
ApeKI GCWGC 4 cut(s) 1013, 1182, 1212, 1674
ApoI RAATTY 3 cut(s) 1031, 1076, 1367
Asp700I GAANNNNTTC 2 cut(s) 1067, 2113
AspLEI GCGC 2 cut(s) 339, 1440
AspS9I GGNCC 3 cut(s) 1382, 1572, 1693
AsuHPI GGTGA 4 cut(s) 92, 167, 299, 806
AvaII GGWCC 2 cut(s) 1382, 1693
BaeGI GKGCMC 1 cut(s) 2032
BaeI ACNNNNGTAYC 2 cut(s) 330, 363
BanI GGYRCC 3 cut(s) 1556, 1664, 1780
BanII GRGCYC 1 cut(s) 1944
BarI GAAGNNNNNNTAC 2 cut(s) 420, 452
Bbv12I GWGCWC 1 cut(s) 324
BbvI GCAGC 4 cut(s) 1025, 1194, 1224, 1686
BccI CCATC 9 cut(s) 83, 323, 781, 1166, 1301, 1381, 1676, 1915, 1996
BciT130I CCWGG 2 cut(s) 1581, 1902
BciVI GTATCC 1 cut(s) 231
BcoDI GTCTC 2 cut(s) 1120, 1799
BcuI ACTAGT 2 cut(s) 866, 1088
BfaI CTAG 4 cut(s) 30, 867, 1089, 1296
BfuAI ACCTGC 1 cut(s) 782
BfuI GTATCC 1 cut(s) 231
BglII AGATCT 4 cut(s) 484, 1201, 1888, 2130
BisI GCNGC 4 cut(s) 1014, 1183, 1213, 1675
BlsI GCNGC 4 cut(s) 1015, 1184, 1214, 1676
Bme1390I CCNGG 2 cut(s) 1581, 1902
Bme18I GGWCC 2 cut(s) 1382, 1693
BmgT120I GGNCC 3 cut(s) 1382, 1572, 1693
BmiI GGNNCC 9 cut(s) 14, 463, 1412, 1558, 1666, 1782, 1819, 2049, 2116
BmrFI CCNGG 2 cut(s) 1581, 1902
BmsI GCATC 1 cut(s) 1237
BpmI CTGGAG 2 cut(s) 852, 1847
BsaBI GATNNNNATC 1 cut(s) 483
BsaHI GRCGYC 1 cut(s) 408
BsaI GGTCTC 1 cut(s) 1799
BsaJI CCNNGG 4 cut(s) 465, 1226, 1900, 1901
BsaXI ACNNNNNCTCC 2 cut(s) 77, 107
Bsc4I CCNNNNNNNGG 2 cut(s) 316, 761
Bse1I ACTGG 2 cut(s) 237, 835
Bse3DI GCAATG 1 cut(s) 1786
Bse8I GATNNNNATC 1 cut(s) 483
BseBI CCWGG 2 cut(s) 1581, 1902
BseDI CCNNGG 4 cut(s) 465, 1226, 1900, 1901
BseGI GGATG 3 cut(s) 94, 1247, 2077
BseJI GATNNNNATC 1 cut(s) 483
BseLI CCNNNNNNNGG 2 cut(s) 316, 761
BseMI GCAATG 1 cut(s) 1786
BseMII CTCAG 3 cut(s) 953, 1242, 1541
BseNI ACTGG 2 cut(s) 237, 835
BseRI GAGGAG 2 cut(s) 314, 1810
BseSI GKGCMC 1 cut(s) 2032
BseXI GCAGC 4 cut(s) 1025, 1194, 1224, 1686
BseYI CCCAGC 2 cut(s) 81, 315
BsgI GTGCAG 3 cut(s) 1032, 1214, 1693
Bsh1236I CGCG 2 cut(s) 70, 1438
BshFI GGCC 3 cut(s) 1574, 1686, 2083
BshNI GGYRCC 3 cut(s) 1556, 1664, 1780
BsiHKAI GWGCWC 1 cut(s) 324
BsiSI CCGG 2 cut(s) 815, 1554
BslFI GGGAC 2 cut(s) 1640, 1857
BslI CCNNNNNNNGG 2 cut(s) 316, 761
BsmAI GTCTC 2 cut(s) 1120, 1799
BsmFI GGGAC 2 cut(s) 1640, 1857
BsmI GAATGC 1 cut(s) 573
BsnI GGCC 3 cut(s) 1574, 1686, 2083
Bso31I GGTCTC 1 cut(s) 1799
Bsp1286I GDGCHC 3 cut(s) 324, 1944, 2032
Bsp1407I TGTACA 1 cut(s) 1322
Bsp19I CCATGG 1 cut(s) 1226
BspACI CCGC 6 cut(s) 59, 70, 215, 1002, 1380, 2011
BspANI GGCC 3 cut(s) 1574, 1686, 2083
BspCNI CTCAG 3 cut(s) 952, 1243, 1540
BspFNI CGCG 2 cut(s) 70, 1438
BspLI GGNNCC 9 cut(s) 14, 463, 1412, 1558, 1666, 1782, 1819, 2049, 2116
BspMI ACCTGC 1 cut(s) 782
BspPI GGATC 5 cut(s) 135, 217, 746, 764, 1635
BspT107I GGYRCC 3 cut(s) 1556, 1664, 1780
BspTNI GGTCTC 1 cut(s) 1799
BsrBI CCGCTC 1 cut(s) 2013
BsrDI GCAATG 1 cut(s) 1786
BsrGI TGTACA 1 cut(s) 1322
BsrI ACTGG 2 cut(s) 237, 835
BssECI CCNNGG 4 cut(s) 465, 1226, 1900, 1901
BssNI GRCGYC 1 cut(s) 408
BssT1I CCWWGG 2 cut(s) 465, 1226
Bst2UI CCWGG 2 cut(s) 1581, 1902
Bst6I CTCTTC 3 cut(s) 1368, 2091, 2104
BstACI GRCGYC 1 cut(s) 408
BstAPI GCANNNNNTGC 2 cut(s) 497, 730
BstAUI TGTACA 1 cut(s) 1322
BstC8I GCNNGC 2 cut(s) 197, 1431
BstDEI CTNAG 5 cut(s) 361, 939, 1251, 1527, 1598
BstDSI CCRYGG 1 cut(s) 1226
BstF5I GGATG 3 cut(s) 94, 1247, 2077
BstFNI CGCG 2 cut(s) 70, 1438
BstHHI GCGC 2 cut(s) 339, 1440
BstMAI GTCTC 2 cut(s) 1120, 1799
BstMWI GCNNNNNNNGC 8 cut(s) 497, 730, 1010, 1274, 1430, 1435, 1571, 1683
BstNI CCWGG 2 cut(s) 1581, 1902
BstNSI RCATGY 2 cut(s) 199, 1179
BstSCI CCNGG 2 cut(s) 1579, 1900
BstSLI GKGCMC 1 cut(s) 2032
BstUI CGCG 2 cut(s) 70, 1438
BstV1I GCAGC 4 cut(s) 1025, 1194, 1224, 1686
BstX2I RGATCY 7 cut(s) 209, 484, 751, 769, 1201, 1888, 2130
BstXI CCANNNNNNTGG 4 cut(s) 384, 591, 1407, 1882
BstYI RGATCY 7 cut(s) 209, 484, 751, 769, 1201, 1888, 2130
BsuI GTATCC 1 cut(s) 231
BsuRI GGCC 3 cut(s) 1574, 1686, 2083
BtgI CCRYGG 1 cut(s) 1226
BtsCI GGATG 3 cut(s) 94, 1247, 2077
BtsI GCAGTG 1 cut(s) 243
BtsIMutI CAGTG 6 cut(s) 243, 653, 828, 1063, 1473, 1992
BveI ACCTGC 1 cut(s) 782
Cac8I GCNNGC 2 cut(s) 197, 1431
CaiI CAGNNNCTG 1 cut(s) 242
CfoI GCGC 2 cut(s) 339, 1440
Cfr13I GGNCC 3 cut(s) 1382, 1572, 1693
CpoI CGGWCCG 1 cut(s) 1382
CseI GACGC 1 cut(s) 397
Csp6I GTAC 6 cut(s) 94, 300, 428, 434, 551, 1323
CspI CGGWCCG 1 cut(s) 1382
CviQI GTAC 6 cut(s) 94, 300, 428, 434, 551, 1323
DdeI CTNAG 5 cut(s) 361, 939, 1251, 1527, 1598
Eam1104I CTCTTC 3 cut(s) 1368, 2091, 2104
EarI CTCTTC 3 cut(s) 1368, 2091, 2104
Eco130I CCWWGG 2 cut(s) 465, 1226
Eco24I GRGCYC 1 cut(s) 1944
Eco31I GGTCTC 1 cut(s) 1799
Eco32I GATATC 1 cut(s) 171
Eco47I GGWCC 2 cut(s) 1382, 1693
Eco57I CTGAAG 3 cut(s) 7, 377, 1254
EcoRII CCWGG 2 cut(s) 1579, 1900
EcoRV GATATC 1 cut(s) 171
EcoT14I CCWWGG 2 cut(s) 465, 1226
EcoT22I ATGCAT 1 cut(s) 201
EcoT38I GRGCYC 1 cut(s) 1944
ErhI CCWWGG 2 cut(s) 465, 1226
FalI AAGNNNNNCTT 2 cut(s) 1825, 1857
FaqI GGGAC 2 cut(s) 1640, 1857
FauI CCCGC 2 cut(s) 208, 2018
FauNDI CATATG 2 cut(s) 625, 1908
FblI GTMKAC 2 cut(s) 713, 857
Fnu4HI GCNGC 4 cut(s) 1014, 1183, 1213, 1675
FokI GGATG 3 cut(s) 101, 1254, 2084
FriOI GRGCYC 1 cut(s) 1944
Fsp4HI GCNGC 4 cut(s) 1014, 1183, 1213, 1675
FspBI CTAG 4 cut(s) 30, 867, 1089, 1296
FspI TGCGCA 1 cut(s) 338
GlaI GCGC 2 cut(s) 338, 1439
GluI GCNGC 4 cut(s) 1014, 1183, 1213, 1675
GsaI CCCAGC 2 cut(s) 85, 319
GsuI CTGGAG 2 cut(s) 852, 1847
HaeIII GGCC 3 cut(s) 1574, 1686, 2083
HapII CCGG 2 cut(s) 815, 1554
HgaI GACGC 1 cut(s) 397
HhaI GCGC 2 cut(s) 339, 1440
Hin1I GRCGYC 1 cut(s) 408
Hin6I GCGC 2 cut(s) 337, 1438
HinP1I GCGC 2 cut(s) 337, 1438
HincII GTYRAC 3 cut(s) 714, 1483, 1983
HindII GTYRAC 3 cut(s) 714, 1483, 1983
HindIII AAGCTT 1 cut(s) 1266
HinfI GANTC 6 cut(s) 65, 353, 516, 629, 974, 1621
HpaI GTTAAC 1 cut(s) 1983
HpaII CCGG 2 cut(s) 815, 1554
HphI GGTGA 4 cut(s) 92, 167, 299, 806
Hpy166II GTNNAC 5 cut(s) 714, 858, 1397, 1483, 1983
Hpy188I TCNGA 9 cut(s) 352, 370, 673, 894, 942, 1306, 1386, 1970, 2135
Hpy8I GTNNAC 5 cut(s) 714, 858, 1397, 1483, 1983
HpyAV CCTTC 4 cut(s) 197, 564, 1563, 1987
HpyCH4IV ACGT 1 cut(s) 668
HpyF10VI GCNNNNNNNGC 8 cut(s) 497, 730, 1010, 1274, 1430, 1435, 1571, 1683
HpyF3I CTNAG 5 cut(s) 361, 939, 1251, 1527, 1598
HpySE526I ACGT 1 cut(s) 668
Hsp92I GRCGYC 1 cut(s) 408
HspAI GCGC 2 cut(s) 337, 1438
KspAI GTTAAC 1 cut(s) 1983
LmnI GCTCC 8 cut(s) 12, 327, 467, 586, 721, 1410, 1823, 2053
Lsp1109I GCAGC 4 cut(s) 1025, 1194, 1224, 1686
LweI GCATC 1 cut(s) 1237
MaeI CTAG 4 cut(s) 30, 867, 1089, 1296
MaeII ACGT 1 cut(s) 668
MaeIII GTNAC 3 cut(s) 98, 249, 594
MbiI CCGCTC 1 cut(s) 2013
MfeI CAATTG 2 cut(s) 225, 1361
MflI RGATCY 7 cut(s) 209, 484, 751, 769, 1201, 1888, 2130
MhlI GDGCHC 3 cut(s) 324, 1944, 2032
MlyI GAGTC 2 cut(s) 347, 638
MmeI TCCRAC 4 cut(s) 582, 764, 1260, 1956
Mph1103I ATGCAT 1 cut(s) 201
MroXI GAANNNNTTC 2 cut(s) 1067, 2113
MseI TTAA 9 cut(s) 177, 563, 611, 648, 783, 1218, 1314, 1721, 1982
MslI CAYNNNNRTG 7 cut(s) 204, 867, 869, 1056, 1463, 1880, 1919
MspA1I CMGCKG 1 cut(s) 1004
MspI CCGG 2 cut(s) 815, 1554
MspR9I CCNGG 2 cut(s) 1581, 1902
MunI CAATTG 2 cut(s) 225, 1361
Mva1269I GAATGC 1 cut(s) 573
MvaI CCWGG 2 cut(s) 1581, 1902
MvnI CGCG 2 cut(s) 70, 1438
MwoI GCNNNNNNNGC 8 cut(s) 497, 730, 1010, 1274, 1430, 1435, 1571, 1683
NcoI CCATGG 1 cut(s) 1226
NdeI CATATG 2 cut(s) 625, 1908
NlaIV GGNNCC 9 cut(s) 14, 463, 1412, 1558, 1666, 1782, 1819, 2049, 2116
NmuCI GTSAC 3 cut(s) 98, 249, 594
NsbI TGCGCA 1 cut(s) 338
NsiI ATGCAT 1 cut(s) 201
NspI RCATGY 2 cut(s) 199, 1179
OliI CACNNNNGTG 3 cut(s) 867, 869, 1056
PaeI GCATGC 1 cut(s) 199
PaqCI CACCTGC 1 cut(s) 782
PasI CCCWGGG 1 cut(s) 1901
PciI ACATGT 1 cut(s) 1175
PctI GAATGC 1 cut(s) 573
PdmI GAANNNNTTC 2 cut(s) 1067, 2113
PfeI GAWTC 4 cut(s) 65, 516, 974, 1621
PflMI CCANNNNNTGG 1 cut(s) 761
PkrI GCNGC 4 cut(s) 1015, 1184, 1214, 1676
PleI GAGTC 2 cut(s) 347, 637
PpsI GAGTC 2 cut(s) 347, 637
PscI ACATGT 1 cut(s) 1175
PsiI TTATAA 1 cut(s) 954
Psp6I CCWGG 2 cut(s) 1579, 1900
PspFI CCCAGC 2 cut(s) 81, 315
PspGI CCWGG 2 cut(s) 1579, 1900
PspN4I GGNNCC 9 cut(s) 14, 463, 1412, 1558, 1666, 1782, 1819, 2049, 2116
PspPI GGNCC 3 cut(s) 1382, 1572, 1693
PstNI CAGNNNCTG 1 cut(s) 242
PsuI RGATCY 7 cut(s) 209, 484, 751, 769, 1201, 1888, 2130
RsaI GTAC 6 cut(s) 95, 301, 429, 435, 552, 1324
RsaNI GTAC 6 cut(s) 94, 300, 428, 434, 551, 1323
RseI CAYNNNNRTG 7 cut(s) 204, 867, 869, 1056, 1463, 1880, 1919
Rsr2I CGGWCCG 1 cut(s) 1382
RsrII CGGWCCG 1 cut(s) 1382
SalI GTCGAC 1 cut(s) 712
SaqAI TTAA 9 cut(s) 177, 563, 611, 648, 783, 1218, 1314, 1721, 1982
SatI GCNGC 4 cut(s) 1014, 1183, 1213, 1675
Sau96I GGNCC 3 cut(s) 1382, 1572, 1693
SchI GAGTC 2 cut(s) 347, 638
ScrFI CCNGG 2 cut(s) 1581, 1902
SduI GDGCHC 3 cut(s) 324, 1944, 2032
SfaNI GCATC 1 cut(s) 1237
SinI GGWCC 2 cut(s) 1382, 1693
SmiMI CAYNNNNRTG 7 cut(s) 204, 867, 869, 1056, 1463, 1880, 1919
SpeI ACTAGT 2 cut(s) 866, 1088
SphI GCATGC 1 cut(s) 199
SsiI CCGC 6 cut(s) 59, 70, 215, 1002, 1380, 2011
SspMI CTAG 4 cut(s) 30, 867, 1089, 1296
StyD4I CCNGG 2 cut(s) 1579, 1900
StyI CCWWGG 2 cut(s) 465, 1226
TaiI ACGT 1 cut(s) 671
TaqI TCGA 4 cut(s) 327, 713, 1645, 1893
TaqII GACCGA 1 cut(s) 1710
TatI WGTACW 3 cut(s) 299, 433, 1322
TfiI GAWTC 4 cut(s) 65, 516, 974, 1621
Tru1I TTAA 9 cut(s) 177, 563, 611, 648, 783, 1218, 1314, 1721, 1982
Tru9I TTAA 9 cut(s) 177, 563, 611, 648, 783, 1218, 1314, 1721, 1982
TscAI CASTG 6 cut(s) 243, 660, 835, 1063, 1480, 1992
TseFI GTSAC 3 cut(s) 98, 249, 594
TseI GCWGC 4 cut(s) 1013, 1182, 1212, 1674
Tsp45I GTSAC 3 cut(s) 98, 249, 594
TspGWI ACGGA 3 cut(s) 459, 709, 1254
TspRI CASTG 6 cut(s) 243, 660, 835, 1063, 1480, 1992
Van91I CCANNNNNTGG 1 cut(s) 761
VpaK11BI GGWCC 2 cut(s) 1382, 1693
XapI RAATTY 3 cut(s) 1031, 1076, 1367
XbaI TCTAGA 1 cut(s) 29
XceI RCATGY 2 cut(s) 199, 1179
XmiI GTMKAC 2 cut(s) 713, 857
XmnI GAANNNNTTC 2 cut(s) 1067, 2113
XspI CTAG 4 cut(s) 30, 867, 1089, 1296
Zsp2I ATGCAT 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.