Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011919.1

Orthogroup ID

OG0003112

Physical Location & Seq

Genomic Coordinates Forward (+)

43426 .. 47681

Gene Structure 4256 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011919.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1254 bp

atgctaaattttgccaggggcagacgagagtcacggtccaatagacccctgtcgcttggaggcatggattacccagatcccaagaggaagaacaattttgtaggaaaaattattttggctgctgcccttacggcgctatgcattatcatgctgaaacaatccccatcgttcaatcctactagcacgttctcccgtcgtgaatcaggagtaacccatgtcctagtaacgggaggtgctggatatattggttcacatgctgcattacgacttctaaaggattcataccgtgtaactattgtggataacctctcacggggaaacctaggtgcagtcaaggttctccaacaactatttcctgagcctgggaggctgcaatttatttatgctgacttgggggatccaaaatccgttaacaaaatattttcagagaatgcatttgatgctgtgatgcattttgcagctgtagcatatgtcggggaaagcacccttgatccacttaagtattaccacaatattacatcaaataccttggtagtagtagaggcgatggccaaacatcgtgtgaggacattaatatattctagcacatgtgcaacatatggagaaccggaaaagatgcctattactgaagaaactacacaggtcccaattaatccatatggaaaagctaagaagatggcagaggatattatcctggatttctctaagaattcaaacatggcagtcatgatcctgagatatttcaatgtgattgggtcagatccagagggcagattaggtgaagctcccagacctgaacttcgtgagcatggacgcatatcaggagcttgttttgatgcagctcgtggtattattcctgggctaaaggttagaggaacagactataaaacagctgatggcacatgcataagggactacattgatgtcactgatctggttgatgcccatgtgaaagctcttgagcacgcaagacccggtaaagtgggaatctacaacgttggcactggaaaaggtagttctgtaaaggagtttgtggaggcatgtaagaaggcaactggggtgaacatcaaagttgatttccttccccgccggcctggcgactatgctgaagtgtacagtgacccatctaagatcttgcgtgaactgaactggacagcacaacacaccaatcttcaagagagtttgcaggttgcgtggagatggcaaaagtcgcaccgtgatggatacggaacccctatggtagtgtcttcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0005975 GO:0005996 GO:0007275 GO:0008150 GO:0008152 GO:0009058 GO:0009790 GO:0009791 GO:0009793 GO:0009832 GO:0009856 GO:0009987 GO:0010154 GO:0012505 GO:0016051 GO:0016853 GO:0016854 GO:0016857 GO:0019321 GO:0019322 GO:0019566 GO:0019567 GO:0022414 GO:0032501 GO:0032502 GO:0042546 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044085 GO:0044238 GO:0044281 GO:0044283 GO:0044424 GO:0044444 GO:0044464 GO:0044706 GO:0046364 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0048868 GO:0050373 GO:0051704 GO:0061458 GO:0071554 GO:0071669 GO:0071704 GO:0071840 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00520 ko01100 map00520 map01100

Pfam Domains

Protein Families

GDP_Man_Dehyd

Protein Analysis

417

Amino Acids

46.05

Weight (kDa)

9.27

Isoelectric Point (pI)

37.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003112)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G20460 AT5G44480 AT5G44480 AT5G44480 AT5G44480
fragaria_vesca	FvH4_3g11380 FvH4_3g11380 FvH4_3g11380 FvH4_3g11380 FvH4_3g11380 FvH4_3g11380
malus_domestica	MD05G1263800.v1.1 MD10G1241500.v1.1
prunus_persica	Prupe.4G101700_v2.0.a1 Prupe.4G101700_v2.0.a1 Prupe.4G101700_v2.0.a1 Prupe.4G101700_v2.0.a1 Prupe.4G101700_v2.0.a1 Prupe.4G101700_v2.0.a1 Prupe.4G101700_v2.0.a1 Prupe.4G101700_v2.0.a1 Prupe.4G101700_v2.0.a1
pyrus_communis	pycom05g24780 pycom10g20250
rosa_chinensis	RchiOBHm_Chr5g0018331
rosa_laevigata	RLG00000032352
rosa_multiflora	Rmu_sc0011919.1_g000008
rosa_roxburghii	Rroxscaffold_1G00059410
rosa_rugosa	Rorug05G0041300 Rorug05G0041300 Rorug05G0041400 Rorug05G0041500
rosa_samantha	Rh5AG134800 Rh5BG133400 Rh5CG145200 Rh5DG134800
rosa_wichuraiana	Rw5G011770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	1177
AciI	CCGC	1 cut(s)	1087
AclI	AACGTT	1 cut(s)	996
AclWI	GGATC	6 cut(s)	71, 392, 405, 485, 724, 755
AcoI	YGGCCR	1 cut(s)	549
AcsI	RAATTY	2 cut(s)	7, 709
AcuI	CTGAAG	2 cut(s)	648, 1128
AfaI	GTAC	1 cut(s)	1115
AfiI	CCNNNNNNNGG	3 cut(s)	226, 313, 362
AflII	CTTAAG	1 cut(s)	497
AflIII	ACRYGT	1 cut(s)	587
AgsI	TTSAA	4 cut(s)	172, 714, 745, 1175
AjnI	CCWGG	5 cut(s)	14, 361, 693, 856, 1093
AjuI	GAANNNNNNNTTGG	2 cut(s)	336, 368
AluBI	AGCT	7 cut(s)	461, 668, 785, 827, 842, 893, 956
AluI	AGCT	7 cut(s)	461, 668, 785, 827, 842, 893, 956
Alw21I	GWGCWC	1 cut(s)	966
AlwI	GGATC	6 cut(s)	71, 392, 405, 485, 724, 755
AoxI	GGCC	2 cut(s)	549, 1091
ApeKI	GCWGC	6 cut(s)	119, 122, 257, 370, 458, 839
ApoI	RAATTY	2 cut(s)	7, 709
ArsI	GACNNNNNNTTYG	2 cut(s)	783, 815
AseI	ATTAAT	2 cut(s)	572, 651
AspA2I	CCTAGG	1 cut(s)	322
AspLEI	GCGC	1 cut(s)	136
AspS9I	GGNCC	2 cut(s)	36, 643
AsuC2I	CCSGG	1 cut(s)	975
AsuHPI	GGTGA	2 cut(s)	791, 1072
AvaII	GGWCC	2 cut(s)	36, 643
AvrII	CCTAGG	1 cut(s)	322
BalI	TGGCCA	1 cut(s)	551
BamHI	GGATCC	1 cut(s)	397
BauI	CACGAG	1 cut(s)	843
BbsI	GAAGAC	1 cut(s)	1239
Bbv12I	GWGCWC	1 cut(s)	966
BbvI	GCAGC	6 cut(s)	106, 109, 244, 357, 470, 851
BccI	CCATC	7 cut(s)	172, 541, 670, 890, 1132, 1194, 1214
BceAI	ACGGC	1 cut(s)	147
BciT130I	CCWGG	5 cut(s)	16, 363, 695, 858, 1095
BciVI	GTATCC	1 cut(s)	1217
BcnI	CCSGG	1 cut(s)	975
BfaI	CTAG	4 cut(s)	180, 221, 323, 582
BfmI	CTRYAG	1 cut(s)	462
BfoI	RGCGCY	1 cut(s)	137
BfrI	CTTAAG	1 cut(s)	497
BfuAI	ACCTGC	1 cut(s)	1177
BfuI	GTATCC	1 cut(s)	1217
BglI	GCCNNNNNGGC	3 cut(s)	131, 367, 1095
BglII	AGATCT	1 cut(s)	1131
BisI	GCNGC	6 cut(s)	120, 123, 258, 371, 459, 840
BlnI	CCTAGG	1 cut(s)	322
BlsI	GCNGC	6 cut(s)	121, 124, 259, 372, 460, 841
Bme1390I	CCNGG	6 cut(s)	16, 363, 695, 858, 975, 1095
Bme18I	GGWCC	2 cut(s)	36, 643
BmgT120I	GGNCC	2 cut(s)	36, 643
BmiI	GGNNCC	3 cut(s)	399, 645, 1231
BmrFI	CCNGG	6 cut(s)	16, 363, 695, 858, 975, 1095
BmrI	ACTGGG	1 cut(s)	1065
BmsI	GCATC	5 cut(s)	430, 438, 606, 826, 931
BmuI	ACTGGG	1 cut(s)	1065
BoxI	GACNNNNGTC	2 cut(s)	28, 49
BpiI	GAAGAC	1 cut(s)	1239
Bpu10I	CCTNAGC	1 cut(s)	357
BpuEI	CTTGAG	1 cut(s)	980
BpuMI	CCSGG	1 cut(s)	975
BsaJI	CCNNGG	5 cut(s)	15, 322, 362, 528, 857
BsaWI	WCCGGW	1 cut(s)	607
Bsc4I	CCNNNNNNNGG	3 cut(s)	226, 313, 362
Bse118I	RCCGGY	1 cut(s)	1089
Bse1I	ACTGG	3 cut(s)	1009, 1060, 1154
BseBI	CCWGG	5 cut(s)	16, 363, 695, 858, 1095
BseDI	CCNNGG	5 cut(s)	15, 322, 362, 528, 857
BseLI	CCNNNNNNNGG	3 cut(s)	226, 313, 362
BseMII	CTCAG	2 cut(s)	348, 725
BseNI	ACTGG	3 cut(s)	1009, 1060, 1154
BseXI	GCAGC	6 cut(s)	106, 109, 244, 357, 470, 851
BsgI	GTGCAG	1 cut(s)	348
BshFI	GGCC	2 cut(s)	551, 1093
BsiHKAI	GWGCWC	1 cut(s)	966
BsiSI	CCGG	3 cut(s)	608, 975, 1090
BslFI	GGGAC	2 cut(s)	629, 926
BslI	CCNNNNNNNGG	3 cut(s)	226, 313, 362
BsmFI	GGGAC	2 cut(s)	629, 926
BsmI	GAATGC	1 cut(s)	436
BsnI	GGCC	2 cut(s)	551, 1093
Bsp1286I	GDGCHC	1 cut(s)	966
Bsp1407I	TGTACA	1 cut(s)	1113
Bsp143I	GATC	7 cut(s)	76, 397, 490, 729, 760, 931, 1131
BspACI	CCGC	1 cut(s)	1087
BspANI	GGCC	2 cut(s)	551, 1093
BspCNI	CTCAG	2 cut(s)	349, 726
BspHI	TCATGA	1 cut(s)	726
BspLI	GGNNCC	3 cut(s)	399, 645, 1231
BspMI	ACCTGC	1 cut(s)	1177
BspPI	GGATC	6 cut(s)	71, 392, 405, 485, 724, 755
BspTI	CTTAAG	1 cut(s)	497
BsrFI	RCCGGY	1 cut(s)	1089
BsrGI	TGTACA	1 cut(s)	1113
BsrI	ACTGG	3 cut(s)	1009, 1060, 1154
BssAI	RCCGGY	1 cut(s)	1089
BssECI	CCNNGG	5 cut(s)	15, 322, 362, 528, 857
BssMI	GATC	7 cut(s)	76, 397, 490, 729, 760, 931, 1131
BssSI	CACGAG	1 cut(s)	843
BssT1I	CCWWGG	2 cut(s)	322, 528
Bst2BI	CACGAG	1 cut(s)	843
Bst2UI	CCWGG	5 cut(s)	16, 363, 695, 858, 1095
Bst4CI	ACNGT	4 cut(s)	36, 287, 1118, 1217
BstAFI	CTTAAG	1 cut(s)	497
BstAPI	GCANNNNNTGC	1 cut(s)	440
BstAUI	TGTACA	1 cut(s)	1113
BstC8I	GCNNGC	2 cut(s)	966, 1091
BstDEI	CTNAG	5 cut(s)	357, 669, 705, 734, 1128
BstH2I	RGCGCY	1 cut(s)	137
BstHHI	GCGC	1 cut(s)	136
BstKTI	GATC	7 cut(s)	79, 400, 493, 732, 763, 934, 1134
BstMBI	GATC	7 cut(s)	76, 397, 490, 729, 760, 931, 1131
BstMWI	GCNNNNNNNGC	6 cut(s)	131, 367, 440, 464, 1095, 1210
BstNI	CCWGG	5 cut(s)	16, 363, 695, 858, 1095
BstNSI	RCATGY	4 cut(s)	257, 591, 906, 1044
BstPAI	GACNNNNGTC	2 cut(s)	28, 49
BstSCI	CCNGG	6 cut(s)	14, 361, 693, 856, 973, 1093
BstSFI	CTRYAG	1 cut(s)	462
BstV1I	GCAGC	6 cut(s)	106, 109, 244, 357, 470, 851
BstV2I	GAAGAC	1 cut(s)	1239
BstX2I	RGATCY	4 cut(s)	76, 397, 760, 1131
BstYI	RGATCY	4 cut(s)	76, 397, 760, 1131
BsuI	GTATCC	1 cut(s)	1217
BsuRI	GGCC	2 cut(s)	551, 1093
BtgZI	GCGATG	1 cut(s)	560
BtsIMutI	CAGTG	3 cut(s)	927, 1002, 1123
BveI	ACCTGC	1 cut(s)	1177
Cac8I	GCNNGC	2 cut(s)	966, 1091
CciI	TCATGA	1 cut(s)	726
CfoI	GCGC	1 cut(s)	136
Cfr10I	RCCGGY	1 cut(s)	1089
Cfr13I	GGNCC	2 cut(s)	36, 643
CseI	GACGC	1 cut(s)	822
Csp6I	GTAC	1 cut(s)	1114
CviQI	GTAC	1 cut(s)	1114
DdeI	CTNAG	5 cut(s)	357, 669, 705, 734, 1128
DpnI	GATC	7 cut(s)	78, 399, 492, 731, 762, 933, 1133
DpnII	GATC	7 cut(s)	76, 397, 490, 729, 760, 931, 1131
EaeI	YGGCCR	1 cut(s)	549
Eco130I	CCWWGG	2 cut(s)	322, 528
Eco47I	GGWCC	2 cut(s)	36, 643
Eco57I	CTGAAG	2 cut(s)	648, 1128
EcoO109I	RGGNCCY	1 cut(s)	643
EcoRI	GAATTC	1 cut(s)	709
EcoRII	CCWGG	5 cut(s)	14, 361, 693, 856, 1093
EcoT14I	CCWWGG	2 cut(s)	322, 528
EcoT22I	ATGCAT	4 cut(s)	143, 436, 453, 908
ErhI	CCWWGG	2 cut(s)	322, 528
FaqI	GGGAC	2 cut(s)	629, 926
FauI	CCCGC	1 cut(s)	1094
FauNDI	CATATG	3 cut(s)	469, 598, 658
Fnu4HI	GCNGC	6 cut(s)	120, 123, 258, 371, 459, 840
Fsp4HI	GCNGC	6 cut(s)	120, 123, 258, 371, 459, 840
FspBI	CTAG	4 cut(s)	180, 221, 323, 582
GlaI	GCGC	1 cut(s)	135
GluI	GCNGC	6 cut(s)	120, 123, 258, 371, 459, 840
HaeII	RGCGCY	1 cut(s)	137
HaeIII	GGCC	2 cut(s)	551, 1093
HapII	CCGG	3 cut(s)	608, 975, 1090
HgaI	GACGC	1 cut(s)	822
HhaI	GCGC	1 cut(s)	136
Hin6I	GCGC	1 cut(s)	134
HinP1I	GCGC	1 cut(s)	134
HincII	GTYRAC	1 cut(s)	412
HindII	GTYRAC	1 cut(s)	412
HinfI	GANTC	4 cut(s)	29, 200, 278, 987
HpaI	GTTAAC	1 cut(s)	412
HpaII	CCGG	3 cut(s)	608, 975, 1090
HphI	GGTGA	2 cut(s)	791, 1072
Hpy166II	GTNNAC	5 cut(s)	251, 412, 1063, 1114, 1142
Hpy188I	TCNGA	2 cut(s)	427, 760
Hpy8I	GTNNAC	5 cut(s)	251, 412, 1063, 1114, 1142
Hpy99I	CGWCG	1 cut(s)	198
HpyAV	CCTTC	2 cut(s)	1042, 1091
HpyCH4III	ACNGT	4 cut(s)	36, 287, 1118, 1217
HpyCH4IV	ACGT	2 cut(s)	185, 996
HpyF10VI	GCNNNNNNNGC	6 cut(s)	131, 367, 440, 464, 1095, 1210
HpyF3I	CTNAG	5 cut(s)	357, 669, 705, 734, 1128
HpySE526I	ACGT	2 cut(s)	185, 996
HspAI	GCGC	1 cut(s)	134
KroI	GCCGGC	1 cut(s)	1089
KroNI	GCCGGC	1 cut(s)	1091
KspAI	GTTAAC	1 cut(s)	412
Kzo9I	GATC	7 cut(s)	76, 397, 490, 729, 760, 931, 1131
LmnI	GCTCC	2 cut(s)	790, 824
Lsp1109I	GCAGC	6 cut(s)	106, 109, 244, 357, 470, 851
LweI	GCATC	5 cut(s)	430, 438, 606, 826, 931
MaeI	CTAG	4 cut(s)	180, 221, 323, 582
MaeII	ACGT	2 cut(s)	185, 996
MaeIII	GTNAC	6 cut(s)	30, 208, 223, 289, 925, 1118
MalI	GATC	7 cut(s)	78, 399, 492, 731, 762, 933, 1133
MboI	GATC	7 cut(s)	76, 397, 490, 729, 760, 931, 1131
MboII	GAAGA	5 cut(s)	100, 641, 685, 1163, 1239
MflI	RGATCY	4 cut(s)	76, 397, 760, 1131
MhlI	GDGCHC	1 cut(s)	966
MlsI	TGGCCA	1 cut(s)	551
MluCI	AATT	6 cut(s)	7, 94, 108, 374, 648, 709
MluNI	TGGCCA	1 cut(s)	551
MlyI	GAGTC	1 cut(s)	38
MmeI	TCCRAC	1 cut(s)	367
Mox20I	TGGCCA	1 cut(s)	551
Mph1103I	ATGCAT	4 cut(s)	143, 436, 453, 908
MroNI	GCCGGC	1 cut(s)	1089
MscI	TGGCCA	1 cut(s)	551
MseI	TTAA	4 cut(s)	411, 498, 572, 651
MslI	CAYNNNNRTG	2 cut(s)	146, 1218
Msp20I	TGGCCA	1 cut(s)	551
MspA1I	CMGCKG	2 cut(s)	461, 893
MspCI	CTTAAG	1 cut(s)	497
MspI	CCGG	3 cut(s)	608, 975, 1090
MspR9I	CCNGG	6 cut(s)	16, 363, 695, 858, 975, 1095
Mva1269I	GAATGC	1 cut(s)	436
MvaI	CCWGG	5 cut(s)	16, 363, 695, 858, 1095
MwoI	GCNNNNNNNGC	6 cut(s)	131, 367, 440, 464, 1095, 1210
NaeI	GCCGGC	1 cut(s)	1091
NciI	CCSGG	1 cut(s)	975
NdeI	CATATG	3 cut(s)	469, 598, 658
NdeII	GATC	7 cut(s)	76, 397, 490, 729, 760, 931, 1131
NgoMIV	GCCGGC	1 cut(s)	1089
NlaIV	GGNNCC	3 cut(s)	399, 645, 1231
NmuCI	GTSAC	3 cut(s)	30, 925, 1118
NsiI	ATGCAT	4 cut(s)	143, 436, 453, 908
NspI	RCATGY	4 cut(s)	257, 591, 906, 1044
PagI	TCATGA	1 cut(s)	726
PciI	ACATGT	1 cut(s)	587
PctI	GAATGC	1 cut(s)	436
PdiI	GCCGGC	1 cut(s)	1091
PfeI	GAWTC	3 cut(s)	200, 278, 987
PfoI	TCCNGGA	1 cut(s)	693
PkrI	GCNGC	6 cut(s)	121, 124, 259, 372, 460, 841
PleI	GAGTC	1 cut(s)	37
PpsI	GAGTC	1 cut(s)	37
PpuMI	RGGWCCY	1 cut(s)	643
PscI	ACATGT	1 cut(s)	587
PshAI	GACNNNNGTC	2 cut(s)	28, 49
PshBI	ATTAAT	2 cut(s)	572, 651
Psp1406I	AACGTT	1 cut(s)	996
Psp5II	RGGWCCY	1 cut(s)	643
Psp6I	CCWGG	5 cut(s)	14, 361, 693, 856, 1093
PspGI	CCWGG	5 cut(s)	14, 361, 693, 856, 1093
PspN4I	GGNNCC	3 cut(s)	399, 645, 1231
PspPI	GGNCC	2 cut(s)	36, 643
PspPPI	RGGWCCY	1 cut(s)	643
PsuI	RGATCY	4 cut(s)	76, 397, 760, 1131
PvuII	CAGCTG	2 cut(s)	461, 893
RsaI	GTAC	1 cut(s)	1115
RsaNI	GTAC	1 cut(s)	1114
RseI	CAYNNNNRTG	2 cut(s)	146, 1218
SaqAI	TTAA	4 cut(s)	411, 498, 572, 651
SatI	GCNGC	6 cut(s)	120, 123, 258, 371, 459, 840
Sau3AI	GATC	7 cut(s)	76, 397, 490, 729, 760, 931, 1131
Sau96I	GGNCC	2 cut(s)	36, 643
SchI	GAGTC	1 cut(s)	38
ScrFI	CCNGG	6 cut(s)	16, 363, 695, 858, 975, 1095
SduI	GDGCHC	1 cut(s)	966
SfaNI	GCATC	5 cut(s)	430, 438, 606, 826, 931
SfcI	CTRYAG	1 cut(s)	462
SinI	GGWCC	2 cut(s)	36, 643
SmiMI	CAYNNNNRTG	2 cut(s)	146, 1218
SmlI	CTYRAG	2 cut(s)	497, 959
SmoI	CTYRAG	2 cut(s)	497, 959
Sse9I	AATT	6 cut(s)	7, 94, 108, 374, 648, 709
SsiI	CCGC	1 cut(s)	1087
SspI	AATATT	2 cut(s)	420, 514
SspMI	CTAG	4 cut(s)	180, 221, 323, 582
StyD4I	CCNGG	6 cut(s)	14, 361, 693, 856, 973, 1093
StyI	CCWWGG	2 cut(s)	322, 528
TaaI	ACNGT	4 cut(s)	36, 287, 1118, 1217
TaiI	ACGT	2 cut(s)	188, 999
TasI	AATT	6 cut(s)	7, 94, 108, 374, 648, 709
TatI	WGTACW	1 cut(s)	1113
TfiI	GAWTC	3 cut(s)	200, 278, 987
Tru1I	TTAA	4 cut(s)	411, 498, 572, 651
Tru9I	TTAA	4 cut(s)	411, 498, 572, 651
TscAI	CASTG	3 cut(s)	934, 1009, 1123
TseFI	GTSAC	3 cut(s)	30, 925, 1118
TseI	GCWGC	6 cut(s)	119, 122, 257, 370, 458, 839
Tsp45I	GTSAC	3 cut(s)	30, 925, 1118
TspDTI	ATGAA	1 cut(s)	270
TspGWI	ACGGA	2 cut(s)	397, 1242
TspRI	CASTG	3 cut(s)	934, 1009, 1123
Vha464I	CTTAAG	1 cut(s)	497
VpaK11BI	GGWCC	2 cut(s)	36, 643
VspI	ATTAAT	2 cut(s)	572, 651
XapI	RAATTY	2 cut(s)	7, 709
XceI	RCATGY	4 cut(s)	257, 591, 906, 1044
XmaJI	CCTAGG	1 cut(s)	322
XspI	CTAG	4 cut(s)	180, 221, 323, 582
Zsp2I	ATGCAT	4 cut(s)	143, 436, 453, 908

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.