Rmu_sc0011953.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011953.1
Physical Location & Seq
Forward (+)
7407 .. 9747
2341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011953.1_g000002.1.cds

Sequence Viewer

Length: 1014 bp
atgttgttggctaatgccaacctcatctcctgcaacttctcaaccttcccatcatcccttccacccaaaacccaaaactccaaaacttcactccaaacccaaatcctcaagcccagaatttcacactccaaaacggcctcaaaagtttcaaccttttttggaccccacaatggtaaagcttcaacctttacattccacaagggccagcttcaaatttgtcacagtaccttgaatagccagaaaccagaagacccagttctgaatgaaggtgaatccttgaagagtgaaaatggtggtgatgaaaggaactggacaacctcaattttgctatttctgttgtggggggcactcatgttctatgtgttcaatctttctccaaatcagaccccgtcaagggacatgtatttcttaaagaaactcttgaatttgaagggagatgatggttttagaatgaatgaagtgcttgtgtctgtctggtacataatgggtttgtggcctttggtgtatagtatgctgctgcttccaacagggagaagctcaaaaagcagcattcctgtctggcctttcttaatactttcattcttcggtggagcatatgcccttcttccatactttgtactttggaaaccaccaccacctactgttgatgaaagtgagctcagaagatggcctctcaactttctagaatctaaattaactgctgggattacacttgctgcagggctgggcatagtcatttatgcaggtctagcgagtggtgctgactggaaggaatattaccagtacttcaatgaaagtaaatttatccatgtcatgagccttgatttcactctactatctgcatttgctccattttgggtttacaacgatatgacttcacgaaaatggtttgccaaaggctcttggcttctgcttttgtcactggtgccgcttctaggccctgctttgtacctcgtcttacgaccatcactgtctactgaacctagttcactgagccctgctgagccagaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

337

Amino Acids

37.84

Weight (kDa)

9.03

Isoelectric Point (pI)

47.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 734
AccB1I GGYRCC 1 cut(s) 925
AccI GTMKAC 1 cut(s) 974
AciI CCGC 1 cut(s) 929
AcsI RAATTY 4 cut(s) 117, 213, 424, 800
AfaI GTAC 5 cut(s) 226, 479, 618, 785, 950
AfiI CCNNNNNNNGG 4 cut(s) 170, 393, 394, 935
AflIII ACRYGT 1 cut(s) 399
AgsI TTSAA 9 cut(s) 150, 183, 212, 232, 280, 367, 424, 430, 790
AluBI AGCT 4 cut(s) 179, 208, 537, 658
AluI AGCT 4 cut(s) 179, 208, 537, 658
Alw21I GWGCWC 1 cut(s) 660
AoxI GGCC 6 cut(s) 135, 202, 494, 560, 668, 937
ApeKI GCWGC 4 cut(s) 514, 517, 546, 716
ApoI RAATTY 4 cut(s) 117, 213, 424, 800
AspS9I GGNCC 3 cut(s) 161, 202, 938
AsuHPI GGTGA 2 cut(s) 281, 308
AvaII GGWCC 1 cut(s) 161
BaeGI GKGCMC 1 cut(s) 349
BanI GGYRCC 1 cut(s) 925
BanII GRGCYC 2 cut(s) 660, 998
BarI GAAGNNNNNNTAC 2 cut(s) 761, 793
BbsI GAAGAC 1 cut(s) 255
Bbv12I GWGCWC 1 cut(s) 660
BbvI GCAGC 4 cut(s) 501, 504, 558, 703
BccI CCATC 4 cut(s) 58, 434, 660, 973
BceAI ACGGC 1 cut(s) 150
BfaI CTAG 4 cut(s) 683, 749, 935, 984
BfmI CTRYAG 1 cut(s) 717
BfuAI ACCTGC 1 cut(s) 734
BisI GCNGC 5 cut(s) 515, 518, 547, 717, 929
BlpI GCTNAGC 1 cut(s) 1002
BlsI GCNGC 5 cut(s) 516, 519, 548, 718, 930
BmcAI AGTACT 1 cut(s) 785
Bme18I GGWCC 1 cut(s) 161
BmgT120I GGNCC 3 cut(s) 161, 202, 938
BmiI GGNNCC 2 cut(s) 163, 927
BmrI ACTGGG 1 cut(s) 248
BmuI ACTGGG 1 cut(s) 248
BpiI GAAGAC 1 cut(s) 255
Bpu1102I GCTNAGC 1 cut(s) 1002
BpuEI CTTGAG 1 cut(s) 92
BsaXI ACNNNNNCTCC 2 cut(s) 11, 41
Bsc4I CCNNNNNNNGG 4 cut(s) 170, 393, 394, 935
Bse1I ACTGG 5 cut(s) 254, 314, 770, 781, 927
BseGI GGATG 1 cut(s) 53
BseLI CCNNNNNNNGG 4 cut(s) 170, 393, 394, 935
BseMII CTCAG 3 cut(s) 673, 983, 993
BseNI ACTGG 5 cut(s) 254, 314, 770, 781, 927
BseSI GKGCMC 1 cut(s) 349
BseXI GCAGC 4 cut(s) 501, 504, 558, 703
BseYI CCCAGC 2 cut(s) 701, 724
BshFI GGCC 6 cut(s) 137, 204, 496, 562, 670, 939
BshNI GGYRCC 1 cut(s) 925
BsiHKAI GWGCWC 1 cut(s) 660
BslFI GGGAC 1 cut(s) 410
BslI CCNNNNNNNGG 4 cut(s) 170, 393, 394, 935
BsmFI GGGAC 1 cut(s) 410
BsmI GAATGC 1 cut(s) 549
BsnI GGCC 6 cut(s) 137, 204, 496, 562, 670, 939
Bsp1286I GDGCHC 3 cut(s) 349, 660, 998
Bsp1720I GCTNAGC 1 cut(s) 1002
BspACI CCGC 1 cut(s) 929
BspANI GGCC 6 cut(s) 137, 204, 496, 562, 670, 939
BspCNI CTCAG 3 cut(s) 672, 984, 994
BspHI TCATGA 1 cut(s) 813
BspLI GGNNCC 2 cut(s) 163, 927
BspMAI CTGCAG 1 cut(s) 721
BspMI ACCTGC 1 cut(s) 734
BspT107I GGYRCC 1 cut(s) 925
BsrI ACTGG 5 cut(s) 254, 314, 770, 781, 927
Bst4CI ACNGT 3 cut(s) 224, 643, 972
Bst6I CTCTTC 1 cut(s) 275
BstC8I GCNNGC 1 cut(s) 206
BstDEI CTNAG 3 cut(s) 659, 992, 1002
BstF5I GGATG 1 cut(s) 53
BstMWI GCNNNNNNNGC 3 cut(s) 543, 749, 758
BstNSI RCATGY 1 cut(s) 403
BstSFI CTRYAG 1 cut(s) 717
BstSLI GKGCMC 1 cut(s) 349
BstV1I GCAGC 4 cut(s) 501, 504, 558, 703
BstV2I GAAGAC 1 cut(s) 255
BsuRI GGCC 6 cut(s) 137, 204, 496, 562, 670, 939
BtsCI GGATG 1 cut(s) 53
BtsIMutI CAGTG 3 cut(s) 920, 968, 989
BveI ACCTGC 1 cut(s) 734
Cac8I GCNNGC 1 cut(s) 206
CciI TCATGA 1 cut(s) 813
Cfr13I GGNCC 3 cut(s) 161, 202, 938
Csp6I GTAC 5 cut(s) 225, 478, 617, 784, 949
CviAII CATG 4 cut(s) 352, 400, 809, 814
CviQI GTAC 5 cut(s) 225, 478, 617, 784, 949
DdeI CTNAG 3 cut(s) 659, 992, 1002
Eam1104I CTCTTC 1 cut(s) 275
EarI CTCTTC 1 cut(s) 275
Ecl136II GAGCTC 1 cut(s) 658
Eco24I GRGCYC 2 cut(s) 660, 998
Eco47I GGWCC 1 cut(s) 161
Eco53kI GAGCTC 1 cut(s) 658
EcoICRI GAGCTC 1 cut(s) 658
EcoO109I RGGNCCY 1 cut(s) 938
EcoT38I GRGCYC 2 cut(s) 660, 998
FaeI CATG 4 cut(s) 355, 403, 812, 817
FalI AAGNNNNNCTT 2 cut(s) 404, 436
FaqI GGGAC 1 cut(s) 410
FatI CATG 4 cut(s) 351, 399, 808, 813
FauNDI CATATG 1 cut(s) 595
FblI GTMKAC 1 cut(s) 974
Fnu4HI GCNGC 5 cut(s) 515, 518, 547, 717, 929
FokI GGATG 1 cut(s) 40
FriOI GRGCYC 2 cut(s) 660, 998
Fsp4HI GCNGC 5 cut(s) 515, 518, 547, 717, 929
FspBI CTAG 4 cut(s) 683, 749, 935, 984
GluI GCNGC 5 cut(s) 515, 518, 547, 717, 929
GsaI CCCAGC 2 cut(s) 705, 728
HaeIII GGCC 6 cut(s) 137, 204, 496, 562, 670, 939
Hin1II CATG 4 cut(s) 355, 403, 812, 817
HindIII AAGCTT 1 cut(s) 177
HinfI GANTC 2 cut(s) 272, 686
HphI GGTGA 2 cut(s) 281, 308
Hpy166II GTNNAC 3 cut(s) 862, 975, 989
Hpy188I TCNGA 3 cut(s) 261, 384, 662
Hpy188III TCNNGA 4 cut(s) 421, 683, 814, 879
Hpy8I GTNNAC 3 cut(s) 862, 975, 989
HpyAV CCTTC 6 cut(s) 55, 68, 260, 424, 611, 763
HpyCH4III ACNGT 3 cut(s) 224, 643, 972
HpyCH4V TGCA 4 cut(s) 33, 719, 743, 842
HpyF10VI GCNNNNNNNGC 3 cut(s) 543, 749, 758
HpyF3I CTNAG 3 cut(s) 659, 992, 1002
Hsp92II CATG 4 cut(s) 355, 403, 812, 817
LmnI GCTCC 2 cut(s) 590, 853
Lsp1109I GCAGC 4 cut(s) 501, 504, 558, 703
MaeI CTAG 4 cut(s) 683, 749, 935, 984
MaeIII GTNAC 2 cut(s) 218, 918
MboII GAAGA 5 cut(s) 260, 292, 574, 596, 675
MhlI GDGCHC 3 cut(s) 349, 660, 998
MluCI AATT 6 cut(s) 117, 213, 321, 424, 692, 800
MmeI TCCRAC 1 cut(s) 548
MnlI CCTC 6 cut(s) 32, 116, 148, 328, 681, 962
MseI TTAA 3 cut(s) 410, 569, 695
MslI CAYNNNNRTG 1 cut(s) 883
Mva1269I GAATGC 1 cut(s) 549
MwoI GCNNNNNNNGC 3 cut(s) 543, 749, 758
NdeI CATATG 1 cut(s) 595
NlaIII CATG 4 cut(s) 355, 403, 812, 817
NlaIV GGNNCC 2 cut(s) 163, 927
NmuCI GTSAC 2 cut(s) 218, 918
NspI RCATGY 1 cut(s) 403
PagI TCATGA 1 cut(s) 813
PciI ACATGT 1 cut(s) 399
PctI GAATGC 1 cut(s) 549
PfeI GAWTC 2 cut(s) 272, 686
PflFI GACNNNGTC 1 cut(s) 388
PkrI GCNGC 5 cut(s) 516, 519, 548, 718, 930
PscI ACATGT 1 cut(s) 399
Psp124BI GAGCTC 1 cut(s) 660
PspFI CCCAGC 2 cut(s) 701, 724
PspN4I GGNNCC 2 cut(s) 163, 927
PspPI GGNCC 3 cut(s) 161, 202, 938
PstI CTGCAG 1 cut(s) 721
PsyI GACNNNGTC 1 cut(s) 388
RsaI GTAC 5 cut(s) 226, 479, 618, 785, 950
RsaNI GTAC 5 cut(s) 225, 478, 617, 784, 949
RseI CAYNNNNRTG 1 cut(s) 883
SacI GAGCTC 1 cut(s) 660
SaqAI TTAA 3 cut(s) 410, 569, 695
SatI GCNGC 5 cut(s) 515, 518, 547, 717, 929
Sau96I GGNCC 3 cut(s) 161, 202, 938
ScaI AGTACT 1 cut(s) 785
SduI GDGCHC 3 cut(s) 349, 660, 998
SfcI CTRYAG 1 cut(s) 717
SinI GGWCC 1 cut(s) 161
SmiMI CAYNNNNRTG 1 cut(s) 883
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
Sse9I AATT 6 cut(s) 117, 213, 321, 424, 692, 800
SsiI CCGC 1 cut(s) 929
SspI AATATT 1 cut(s) 776
SspMI CTAG 4 cut(s) 683, 749, 935, 984
SstI GAGCTC 1 cut(s) 660
TaaI ACNGT 3 cut(s) 224, 643, 972
TasI AATT 6 cut(s) 117, 213, 321, 424, 692, 800
TatI WGTACW 2 cut(s) 616, 783
TauI GCSGC 1 cut(s) 931
TfiI GAWTC 2 cut(s) 272, 686
Tru1I TTAA 3 cut(s) 410, 569, 695
Tru9I TTAA 3 cut(s) 410, 569, 695
TscAI CASTG 3 cut(s) 927, 975, 996
TseFI GTSAC 2 cut(s) 218, 918
TseI GCWGC 4 cut(s) 514, 517, 546, 716
Tsp45I GTSAC 2 cut(s) 218, 918
TspDTI ATGAA 7 cut(s) 279, 315, 467, 471, 567, 663, 807
TspRI CASTG 3 cut(s) 927, 975, 996
Tth111I GACNNNGTC 1 cut(s) 388
VpaK11BI GGWCC 1 cut(s) 161
XapI RAATTY 4 cut(s) 117, 213, 424, 800
XbaI TCTAGA 1 cut(s) 682
XceI RCATGY 1 cut(s) 403
XmiI GTMKAC 1 cut(s) 974
XspI CTAG 4 cut(s) 683, 749, 935, 984
ZrmI AGTACT 1 cut(s) 785
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.