Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012840.1

Orthogroup ID

OG0011118

Physical Location & Seq

Genomic Coordinates Reverse (-)

8693 .. 9481

Gene Structure 789 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012840.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 789 bp

atggcaaatgggactctcagaagtcatctctttggaagtgaactcccaccgttgacgtggaagcagcgagtagaagcatgcattggtgctgctcgaggactacattaccttcataccggagcagataggggggtaatccacagggatgttaagacaaccaacatactgctagatgagaactttgtagcaaagatgtccgactttggactgtcgaaaactggtcctgctttggaccatacccatgttagtactgcagttaaaggaagctttggatatctagatcctgagtattttcgacgacagcagctgacagagaaatcggatgtctactcttttggtgtagtgttgtttgaagctgtttgttctcggccagtcataaacccaaccttgccaaaagatcagatcaatcttgcagaatgggcaatgagatggcagaggcagaggtcacttgaaactatcatcgatccttgtcttgaaggaaactactgtcctgagtccttgaagaagtttggggacatagcagagaaatgccttgctgatgaggggaagagccggccaacgatgggggaagttttgtggcacttggagtatgtcttgcaactccacgaagcatggatccggaaaaatgcaggagagaattctttgacaagcagtcaaggatttgggggtttagcagtggatgaagcagaagagagggaagctaccagtttcgatgaagagactggtttcagcagagagtctactagtagaggacttgatgaatctactacagaacgcagaaagagttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000902 GO:0005575 GO:0005623 GO:0005886 GO:0008150 GO:0009653 GO:0009719 GO:0009725 GO:0009741 GO:0009826 GO:0009987 GO:0010033 GO:0014070 GO:0016020 GO:0016043 GO:0016049 GO:0032502 GO:0032989 GO:0033993 GO:0040007 GO:0042221 GO:0044464 GO:0048589 GO:0048856 GO:0048869 GO:0050896 GO:0060560 GO:0071840 GO:0071944 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Malectin_like Pkinase_Tyr

Protein Analysis

262

Amino Acids

29.38

Weight (kDa)

5.56

Isoelectric Point (pI)

45.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011118)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30570
fragaria_vesca	FvH4_3g10180
malus_domestica	MD01G1121700.v1.1 MD10G1252700.v1.1
prunus_persica	Prupe.4G090800_v2.0.a1
pyrus_communis	pycom05g25440 pycom10g20840
rosa_chinensis	RchiOBHm_Chr5g0016361
rosa_laevigata	RLG00000032246
rosa_multiflora	Rmu_sc0001235.1_g000034 Rmu_sc0012840.1_g000004 Rmu_sc0023137.1_g000012
rosa_roxburghii	Rroxscaffold_1G00060500 Rroxscaffold_1G00060510
rosa_rugosa	Rorug05G0031900
rosa_samantha	Rh5AG125400 Rh5BG124400 Rh5CG136600 Rh5DG124100
rosa_wichuraiana	Rw5G010870

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	327, 740
AccIII	TCCGGA	1 cut(s)	618
AclWI	GGATC	4 cut(s)	275, 458, 610, 623
AcoI	YGGCCR	2 cut(s)	368, 554
AcsI	RAATTY	1 cut(s)	637
AfaI	GTAC	1 cut(s)	250
AfiI	CCNNNNNNNGG	1 cut(s)	563
AgsI	TTSAA	4 cut(s)	353, 452, 476, 502
AhdI	GACNNNNNGTC	1 cut(s)	651
AhlI	ACTAGT	1 cut(s)	743
AjiI	CACGTC	1 cut(s)	57
AjuI	GAANNNNNNNTTGG	2 cut(s)	66, 98
AluBI	AGCT	4 cut(s)	267, 307, 356, 701
AluI	AGCT	4 cut(s)	267, 307, 356, 701
Alw26I	GTCTC	1 cut(s)	713
AlwI	GGATC	4 cut(s)	275, 458, 610, 623
AlwNI	CAGNNNCTG	1 cut(s)	307
Ama87I	CYCGRG	1 cut(s)	93
Aor13HI	TCCGGA	1 cut(s)	618
AoxI	GGCC	2 cut(s)	368, 554
ApeKI	GCWGC	3 cut(s)	64, 89, 304
ApoI	RAATTY	1 cut(s)	637
AspS9I	GGNCC	2 cut(s)	221, 232
AvaI	CYCGRG	1 cut(s)	93
AvaII	GGWCC	2 cut(s)	221, 232
BamHI	GGATCC	1 cut(s)	615
BbvI	GCAGC	3 cut(s)	76, 76, 316
BccI	CCATC	2 cut(s)	423, 556
BcoDI	GTCTC	1 cut(s)	713
BcuI	ACTAGT	1 cut(s)	743
BfaI	CTAG	3 cut(s)	170, 278, 744
BfmI	CTRYAG	2 cut(s)	252, 768
BisI	GCNGC	3 cut(s)	65, 90, 305
BlsI	GCNGC	3 cut(s)	66, 91, 306
BmcAI	AGTACT	1 cut(s)	250
Bme18I	GGWCC	2 cut(s)	221, 232
BmeRI	GACNNNNNGTC	1 cut(s)	651
BmeT110I	CYCGRG	1 cut(s)	93
BmgBI	CACGTC	1 cut(s)	57
BmgT120I	GGNCC	2 cut(s)	221, 232
BmiI	GGNNCC	1 cut(s)	617
Bsa29I	ATCGAT	1 cut(s)	462
BsaWI	WCCGGW	2 cut(s)	116, 618
Bsc4I	CCNNNNNNNGG	1 cut(s)	563
Bse118I	RCCGGY	1 cut(s)	552
Bse1I	ACTGG	4 cut(s)	223, 371, 705, 727
Bse3DI	GCAATG	1 cut(s)	429
BseAI	TCCGGA	1 cut(s)	618
BseCI	ATCGAT	1 cut(s)	462
BseGI	GGATG	3 cut(s)	151, 328, 685
BseLI	CCNNNNNNNGG	1 cut(s)	563
BseMI	GCAATG	1 cut(s)	429
BseMII	CTCAG	3 cut(s)	31, 276, 483
BseNI	ACTGG	4 cut(s)	223, 371, 705, 727
BseXI	GCAGC	3 cut(s)	76, 76, 316
BshFI	GGCC	2 cut(s)	370, 556
BshVI	ATCGAT	1 cut(s)	462
BsiHKCI	CYCGRG	1 cut(s)	93
BsiSI	CCGG	3 cut(s)	117, 553, 619
BslFI	GGGAC	2 cut(s)	25, 527
BslI	CCNNNNNNNGG	1 cut(s)	563
BsmAI	GTCTC	1 cut(s)	713
BsmFI	GGGAC	2 cut(s)	25, 527
BsnI	GGCC	2 cut(s)	370, 556
BsoBI	CYCGRG	1 cut(s)	93
Bsp13I	TCCGGA	1 cut(s)	618
Bsp143I	GATC	5 cut(s)	280, 397, 402, 463, 615
BspANI	GGCC	2 cut(s)	370, 556
BspCNI	CTCAG	3 cut(s)	30, 277, 484
BspDI	ATCGAT	1 cut(s)	462
BspEI	TCCGGA	1 cut(s)	618
BspLI	GGNNCC	1 cut(s)	617
BspMAI	CTGCAG	1 cut(s)	256
BspPI	GGATC	4 cut(s)	275, 458, 610, 623
BspQI	GCTCTTC	1 cut(s)	542
BsrDI	GCAATG	1 cut(s)	429
BsrFI	RCCGGY	1 cut(s)	552
BsrI	ACTGG	4 cut(s)	223, 371, 705, 727
BssAI	RCCGGY	1 cut(s)	552
BssMI	GATC	5 cut(s)	280, 397, 402, 463, 615
Bst4CI	ACNGT	3 cut(s)	51, 210, 488
Bst6I	CTCTTC	3 cut(s)	542, 684, 711
BstC8I	GCNNGC	2 cut(s)	79, 554
BstDEI	CTNAG	3 cut(s)	17, 285, 492
BstF5I	GGATG	3 cut(s)	151, 328, 685
BstKTI	GATC	5 cut(s)	283, 400, 405, 466, 618
BstMAI	GTCTC	1 cut(s)	713
BstMBI	GATC	5 cut(s)	280, 397, 402, 463, 615
BstMWI	GCNNNNNNNGC	1 cut(s)	419
BstNSI	RCATGY	1 cut(s)	81
BstSFI	CTRYAG	2 cut(s)	252, 768
BstV1I	GCAGC	3 cut(s)	76, 76, 316
BstX2I	RGATCY	2 cut(s)	280, 615
BstYI	RGATCY	2 cut(s)	280, 615
Bsu15I	ATCGAT	1 cut(s)	462
BsuRI	GGCC	2 cut(s)	370, 556
BsuTUI	ATCGAT	1 cut(s)	462
BtrI	CACGTC	1 cut(s)	57
BtsCI	GGATG	3 cut(s)	151, 328, 685
BtsI	GCAGTG	1 cut(s)	681
BtsIMutI	CAGTG	1 cut(s)	681
Cac8I	GCNNGC	2 cut(s)	79, 554
CaiI	CAGNNNCTG	1 cut(s)	307
Cfr10I	RCCGGY	1 cut(s)	552
Cfr13I	GGNCC	2 cut(s)	221, 232
ClaI	ATCGAT	1 cut(s)	462
Csp6I	GTAC	1 cut(s)	249
CviAII	CATG	3 cut(s)	78, 242, 612
CviJI	RGCY	7 cut(s)	267, 307, 356, 370, 552, 556, 701
CviKI_1	RGCY	7 cut(s)	267, 307, 356, 370, 552, 556, 701
CviQI	GTAC	1 cut(s)	249
DdeI	CTNAG	3 cut(s)	17, 285, 492
DpnI	GATC	5 cut(s)	282, 399, 404, 465, 617
DpnII	GATC	5 cut(s)	280, 397, 402, 463, 615
DriI	GACNNNNNGTC	1 cut(s)	651
EaeI	YGGCCR	2 cut(s)	368, 554
Eam1104I	CTCTTC	3 cut(s)	542, 684, 711
Eam1105I	GACNNNNNGTC	1 cut(s)	651
EarI	CTCTTC	3 cut(s)	542, 684, 711
Eco32I	GATATC	1 cut(s)	275
Eco47I	GGWCC	2 cut(s)	221, 232
Eco88I	CYCGRG	1 cut(s)	93
EcoRI	GAATTC	1 cut(s)	637
EcoRV	GATATC	1 cut(s)	275
EcoT22I	ATGCAT	1 cut(s)	83
FaeI	CATG	3 cut(s)	81, 245, 615
FaiI	YATR	9 cut(s)	79, 114, 164, 237, 243, 377, 518, 591, 613
FaqI	GGGAC	2 cut(s)	25, 527
FatI	CATG	3 cut(s)	77, 241, 611
FblI	GTMKAC	2 cut(s)	327, 740
Fnu4HI	GCNGC	3 cut(s)	65, 90, 305
FokI	GGATG	3 cut(s)	158, 335, 692
Fsp4HI	GCNGC	3 cut(s)	65, 90, 305
FspBI	CTAG	3 cut(s)	170, 278, 744
GluI	GCNGC	3 cut(s)	65, 90, 305
HaeIII	GGCC	2 cut(s)	370, 556
HapII	CCGG	3 cut(s)	117, 553, 619
Hin1II	CATG	3 cut(s)	81, 245, 615
HincII	GTYRAC	1 cut(s)	54
HindII	GTYRAC	1 cut(s)	54
HindIII	AAGCTT	1 cut(s)	265
HinfI	GANTC	4 cut(s)	13, 494, 737, 761
HpaII	CCGG	3 cut(s)	117, 553, 619
Hpy166II	GTNNAC	4 cut(s)	41, 54, 328, 741
Hpy188I	TCNGA	4 cut(s)	20, 199, 322, 402
Hpy188III	TCNNGA	5 cut(s)	278, 284, 473, 491, 619
Hpy8I	GTNNAC	4 cut(s)	41, 54, 328, 741
Hpy99I	CGWCG	1 cut(s)	300
HpyAV	CCTTC	2 cut(s)	119, 470
HpyCH4III	ACNGT	3 cut(s)	51, 210, 488
HpyCH4IV	ACGT	1 cut(s)	56
HpyCH4V	TGCA	5 cut(s)	81, 254, 413, 598, 629
HpyF10VI	GCNNNNNNNGC	1 cut(s)	419
HpyF3I	CTNAG	3 cut(s)	17, 285, 492
HpySE526I	ACGT	1 cut(s)	56
Hsp92II	CATG	3 cut(s)	81, 245, 615
Kpn2I	TCCGGA	1 cut(s)	618
KroI	GCCGGC	1 cut(s)	552
KroNI	GCCGGC	1 cut(s)	554
Kzo9I	GATC	5 cut(s)	280, 397, 402, 463, 615
LguI	GCTCTTC	1 cut(s)	542
LmnI	GCTCC	1 cut(s)	119
Lsp1109I	GCAGC	3 cut(s)	76, 76, 316
MaeI	CTAG	3 cut(s)	170, 278, 744
MaeII	ACGT	1 cut(s)	56
MaeIII	GTNAC	1 cut(s)	444
MalI	GATC	5 cut(s)	282, 399, 404, 465, 617
MboI	GATC	5 cut(s)	280, 397, 402, 463, 615
MboII	GAAGA	4 cut(s)	514, 559, 701, 728
MflI	RGATCY	2 cut(s)	280, 615
MluCI	AATT	1 cut(s)	637
MlyI	GAGTC	3 cut(s)	7, 503, 746
MmeI	TCCRAC	1 cut(s)	222
MnlI	CCTC	6 cut(s)	89, 429, 435, 535, 687, 743
Mph1103I	ATGCAT	1 cut(s)	83
MroI	TCCGGA	1 cut(s)	618
MroNI	GCCGGC	1 cut(s)	552
MseI	TTAA	2 cut(s)	150, 258
MslI	CAYNNNNRTG	2 cut(s)	144, 240
MspA1I	CMGCKG	1 cut(s)	307
MspI	CCGG	3 cut(s)	117, 553, 619
MwoI	GCNNNNNNNGC	1 cut(s)	419
NaeI	GCCGGC	1 cut(s)	554
NdeII	GATC	5 cut(s)	280, 397, 402, 463, 615
NgoMIV	GCCGGC	1 cut(s)	552
NlaIII	CATG	3 cut(s)	81, 245, 615
NlaIV	GGNNCC	1 cut(s)	617
NmeAIII	GCCGAG	1 cut(s)	346
NmuCI	GTSAC	1 cut(s)	444
NsiI	ATGCAT	1 cut(s)	83
NspI	RCATGY	1 cut(s)	81
PaeI	GCATGC	1 cut(s)	81
PaeR7I	CTCGAG	1 cut(s)	93
PciSI	GCTCTTC	1 cut(s)	542
PdiI	GCCGGC	1 cut(s)	554
PfeI	GAWTC	1 cut(s)	761
PkrI	GCNGC	3 cut(s)	66, 91, 306
PleI	GAGTC	3 cut(s)	7, 502, 745
PpsI	GAGTC	3 cut(s)	7, 502, 745
PspN4I	GGNNCC	1 cut(s)	617
PspPI	GGNCC	2 cut(s)	221, 232
PspXI	VCTCGAGB	1 cut(s)	93
PstI	CTGCAG	1 cut(s)	256
PstNI	CAGNNNCTG	1 cut(s)	307
PsuI	RGATCY	2 cut(s)	280, 615
PvuII	CAGCTG	1 cut(s)	307
RsaI	GTAC	1 cut(s)	250
RsaNI	GTAC	1 cut(s)	249
RseI	CAYNNNNRTG	2 cut(s)	144, 240
SapI	GCTCTTC	1 cut(s)	542
SaqAI	TTAA	2 cut(s)	150, 258
SatI	GCNGC	3 cut(s)	65, 90, 305
Sau3AI	GATC	5 cut(s)	280, 397, 402, 463, 615
Sau96I	GGNCC	2 cut(s)	221, 232
ScaI	AGTACT	1 cut(s)	250
SchI	GAGTC	3 cut(s)	7, 503, 746
SetI	ASST	8 cut(s)	59, 111, 269, 309, 358, 389, 446, 703
SfcI	CTRYAG	2 cut(s)	252, 768
Sfr274I	CTCGAG	1 cut(s)	93
SinI	GGWCC	2 cut(s)	221, 232
SlaI	CTCGAG	1 cut(s)	93
SmiMI	CAYNNNNRTG	2 cut(s)	144, 240
SmlI	CTYRAG	1 cut(s)	93
SmoI	CTYRAG	1 cut(s)	93
SpeI	ACTAGT	1 cut(s)	743
SphI	GCATGC	1 cut(s)	81
Sse9I	AATT	1 cut(s)	637
SspMI	CTAG	3 cut(s)	170, 278, 744
TaaI	ACNGT	3 cut(s)	51, 210, 488
TaiI	ACGT	1 cut(s)	59
TaqI	TCGA	5 cut(s)	94, 212, 295, 462, 711
TasI	AATT	1 cut(s)	637
TatI	WGTACW	1 cut(s)	248
TfiI	GAWTC	1 cut(s)	761
Tru1I	TTAA	2 cut(s)	150, 258
Tru9I	TTAA	2 cut(s)	150, 258
TscAI	CASTG	1 cut(s)	681
TseFI	GTSAC	1 cut(s)	444
TseI	GCWGC	3 cut(s)	64, 89, 304
Tsp45I	GTSAC	1 cut(s)	444
TspDTI	ATGAA	4 cut(s)	101, 696, 729, 774
TspRI	CASTG	1 cut(s)	681
VpaK11BI	GGWCC	2 cut(s)	221, 232
XapI	RAATTY	1 cut(s)	637
XbaI	TCTAGA	1 cut(s)	277
XceI	RCATGY	1 cut(s)	81
XcmI	CCANNNNNNNNNTGG	1 cut(s)	54
XhoI	CTCGAG	1 cut(s)	93
XmiI	GTMKAC	2 cut(s)	327, 740
XspI	CTAG	3 cut(s)	170, 278, 744
ZrmI	AGTACT	1 cut(s)	250
Zsp2I	ATGCAT	1 cut(s)	83

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.