Rmu_sc0013411.1_g000002

Belongs to the glycosyltransferase 31 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013411.1
OG0013382
Physical Location & Seq
Forward (+)
20035 .. 20997
963 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013411.1_g000002.1.cds

Sequence Viewer

Length: 963 bp
atgaagacttcaaggccagaccggcgacggttcatcatttcttctttcttcttcatttgtttcctctgtgccttggcttctataaacgaagtacgattcggtagtcttctgaactttggtcgctgtgctcttacaaaaaccaactctccttctcagatatataattcctcaagcaccttgatcgaaacccagaagacttcatctgaggatgaaattcgtgtactttttggcattctaacccttccagaccaataccaacgacgacacttcctgcgtttaatctatggcactcagaatcccgtgggggcaaaagtggacgtgaagtttgtgttctgcaacctcacaaaggaagaccagaaggtactcgttgcactagaaataatgcgctatgatgacattatcattctcgattgcaaggagaatatgaacaagggtaagacttacacctacttttcaagcctgccggagattttcaacgatacagatggggtgtatccaccttatcattatgtaatgaaagccgatgatgatgcttactttcggcttcaaagcttggtcgactctttgaagcctttgcctagagaagacttgtactatggttatgtgattccatgcccaagcatggacccttttgtgcattacatgtctggaatggggtatttgatttcttgggatatagttgagtggatcagagactcagatatccccaagaaccaattagaaggccccgaggacaaaatttttggtgagtggattagaaatgggcatcgagctaagaataggttcaacgctaagtggagtatgtacaattttccagagccacctacaagatgtactcatgagctttggccggatacgattgcagttcatttgttgaagactcaggaaaagtggattcggacattgaaatacttcaatgtcactgataatctcaagccatccaaattgtatcatataccttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Galactosyl_T

Protein Analysis

320

Amino Acids

37.55

Weight (kDa)

8.05

Isoelectric Point (pI)

40.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013382)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G57500
fragaria_vesca FvH4_4g09410
malus_domestica MD13G1256400.v1.1
prunus_persica Prupe.1G086900_v2.0.a1 Prupe.1G087000_v2.0.a1
pyrus_communis pycom13g22010
rosa_chinensis RchiOBHm_Chr4g0402651
rosa_laevigata RLG00000009054
rosa_multiflora Rmu_sc0009850.1_g000009 Rmu_sc0013411.1_g000002
rosa_roxburghii Rroxscaffold_5G00347400
rosa_rugosa Rorug04G0037400
rosa_samantha Rh4AG115000 Rh4BG107600 Rh4CG121900 Rh4DG107400
rosa_wichuraiana Rw0G015100 Rw4G009170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 558
AclWI GGATC 1 cut(s) 695
AcoI YGGCCR 1 cut(s) 848
AcsI RAATTY 2 cut(s) 213, 738
AfaI GTAC 6 cut(s) 93, 222, 363, 593, 806, 835
AfiI CCNNNNNNNGG 2 cut(s) 346, 622
AflIII ACRYGT 1 cut(s) 642
AgsI TTSAA 9 cut(s) 12, 456, 475, 548, 568, 787, 877, 907, 916
AjiI CACGTC 1 cut(s) 319
AluBI AGCT 3 cut(s) 552, 773, 844
AluI AGCT 3 cut(s) 552, 773, 844
Alw21I GWGCWC 1 cut(s) 130
Alw26I GTCTC 1 cut(s) 687
AlwI GGATC 1 cut(s) 695
Ama87I CYCGRG 1 cut(s) 728
AoxI GGCC 3 cut(s) 14, 724, 848
ApoI RAATTY 2 cut(s) 213, 738
ArsI GACNNNNNNTTYG 4 cut(s) 308, 340, 725, 757
Asp700I GAANNNNTTC 2 cut(s) 782, 911
AspLEI GCGC 1 cut(s) 387
AspS9I GGNCC 2 cut(s) 625, 725
AsuHPI GGTGA 1 cut(s) 758
AvaI CYCGRG 1 cut(s) 728
AvaII GGWCC 1 cut(s) 625
BbsI GAAGAC 6 cut(s) 11, 98, 200, 357, 591, 884
Bbv12I GWGCWC 1 cut(s) 130
BccI CCATC 2 cut(s) 479, 946
BcgI CGANNNNNNTGC 4 cut(s) 163, 197, 512, 546
BciVI GTATCC 2 cut(s) 504, 847
BcoDI GTCTC 1 cut(s) 687
BfaI CTAG 2 cut(s) 374, 579
BfuI GTATCC 2 cut(s) 504, 847
BglI GCCNNNNNGGC 1 cut(s) 22
Bme18I GGWCC 1 cut(s) 625
BmeT110I CYCGRG 1 cut(s) 728
BmgBI CACGTC 1 cut(s) 319
BmgT120I GGNCC 2 cut(s) 625, 725
BmiI GGNNCC 2 cut(s) 627, 727
BmsI GCATC 2 cut(s) 520, 775
BpiI GAAGAC 6 cut(s) 11, 98, 200, 357, 591, 884
BpuEI CTTGAG 2 cut(s) 154, 917
BsaJI CCNNGG 3 cut(s) 72, 300, 729
BsaXI ACNNNNNCTCC 2 cut(s) 130, 160
Bsc4I CCNNNNNNNGG 2 cut(s) 346, 622
Bse118I RCCGGY 1 cut(s) 21
BseDI CCNNGG 3 cut(s) 72, 300, 729
BseGI GGATG 2 cut(s) 214, 938
BseLI CCNNNNNNNGG 2 cut(s) 346, 622
BseMII CTCAG 5 cut(s) 167, 195, 305, 711, 896
BshFI GGCC 3 cut(s) 16, 726, 850
BsiHKAI GWGCWC 1 cut(s) 130
BsiHKCI CYCGRG 1 cut(s) 728
BsiSI CCGG 3 cut(s) 22, 464, 851
BslI CCNNNNNNNGG 2 cut(s) 346, 622
BsmAI GTCTC 1 cut(s) 687
BsmI GAATGC 1 cut(s) 231
BsnI GGCC 3 cut(s) 16, 726, 850
BsoBI CYCGRG 1 cut(s) 728
Bsp1286I GDGCHC 1 cut(s) 130
Bsp1407I TGTACA 1 cut(s) 804
Bsp143I GATC 2 cut(s) 180, 687
BspANI GGCC 3 cut(s) 16, 726, 850
BspCNI CTCAG 5 cut(s) 166, 196, 304, 710, 895
BspHI TCATGA 1 cut(s) 838
BspLI GGNNCC 2 cut(s) 627, 727
BspPI GGATC 1 cut(s) 695
BsrFI RCCGGY 1 cut(s) 21
BsrGI TGTACA 1 cut(s) 804
BssAI RCCGGY 1 cut(s) 21
BssECI CCNNGG 3 cut(s) 72, 300, 729
BssMI GATC 2 cut(s) 180, 687
BssT1I CCWWGG 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 30
BstAUI TGTACA 1 cut(s) 804
BstC8I GCNNGC 1 cut(s) 461
BstDEI CTNAG 8 cut(s) 153, 204, 291, 697, 774, 792, 882, 960
BstDSI CCRYGG 1 cut(s) 300
BstENI CCTNNNNNAGG 1 cut(s) 344
BstF5I GGATG 2 cut(s) 214, 938
BstHHI GCGC 1 cut(s) 387
BstKTI GATC 2 cut(s) 183, 690
BstMAI GTCTC 1 cut(s) 687
BstMBI GATC 2 cut(s) 180, 687
BstMWI GCNNNNNNNGC 1 cut(s) 22
BstNSI RCATGY 1 cut(s) 646
BstV2I GAAGAC 6 cut(s) 11, 98, 200, 357, 591, 884
BsuI GTATCC 2 cut(s) 504, 847
BsuRI GGCC 3 cut(s) 16, 726, 850
BtgI CCRYGG 1 cut(s) 300
BtrI CACGTC 1 cut(s) 319
BtsCI GGATG 2 cut(s) 214, 938
BtsIMutI CAGTG 1 cut(s) 921
Cac8I GCNNGC 1 cut(s) 461
CciI TCATGA 1 cut(s) 838
CfoI GCGC 1 cut(s) 387
Cfr10I RCCGGY 1 cut(s) 21
Cfr13I GGNCC 2 cut(s) 625, 725
Csp6I GTAC 6 cut(s) 92, 221, 362, 592, 805, 834
CviAII CATG 4 cut(s) 612, 622, 643, 839
CviQI GTAC 6 cut(s) 92, 221, 362, 592, 805, 834
DdeI CTNAG 8 cut(s) 153, 204, 291, 697, 774, 792, 882, 960
DpnI GATC 2 cut(s) 182, 689
DpnII GATC 2 cut(s) 180, 687
EaeI YGGCCR 1 cut(s) 848
Eco130I CCWWGG 1 cut(s) 72
Eco32I GATATC 1 cut(s) 703
Eco47I GGWCC 1 cut(s) 625
Eco88I CYCGRG 1 cut(s) 728
EcoNI CCTNNNNNAGG 1 cut(s) 344
EcoO109I RGGNCCY 1 cut(s) 725
EcoRV GATATC 1 cut(s) 703
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaeI CATG 4 cut(s) 615, 625, 646, 842
FatI CATG 4 cut(s) 611, 621, 642, 838
FblI GTMKAC 1 cut(s) 558
FokI GGATG 2 cut(s) 221, 925
FspBI CTAG 2 cut(s) 374, 579
GlaI GCGC 1 cut(s) 386
HaeIII GGCC 3 cut(s) 16, 726, 850
HapII CCGG 3 cut(s) 22, 464, 851
HhaI GCGC 1 cut(s) 387
Hin1II CATG 4 cut(s) 615, 625, 646, 842
Hin6I GCGC 1 cut(s) 385
HinP1I GCGC 1 cut(s) 385
HincII GTYRAC 1 cut(s) 559
HindII GTYRAC 1 cut(s) 559
HindIII AAGCTT 1 cut(s) 550
HinfI GANTC 7 cut(s) 96, 295, 560, 607, 695, 880, 895
HpaII CCGG 3 cut(s) 22, 464, 851
HphI GGTGA 1 cut(s) 758
Hpy166II GTNNAC 3 cut(s) 221, 316, 559
Hpy188I TCNGA 7 cut(s) 111, 156, 205, 294, 692, 700, 900
Hpy188III TCNNGA 6 cut(s) 245, 407, 648, 815, 839, 884
Hpy8I GTNNAC 3 cut(s) 221, 316, 559
Hpy99I CGWCG 2 cut(s) 30, 264
HpyAV CCTTC 4 cut(s) 159, 251, 352, 716
HpyCH4III ACNGT 1 cut(s) 30
HpyCH4IV ACGT 1 cut(s) 318
HpyCH4V TGCA 5 cut(s) 336, 371, 414, 637, 863
HpyF10VI GCNNNNNNNGC 1 cut(s) 22
HpyF3I CTNAG 8 cut(s) 153, 204, 291, 697, 774, 792, 882, 960
HpySE526I ACGT 1 cut(s) 318
Hsp92II CATG 4 cut(s) 615, 625, 646, 842
HspAI GCGC 1 cut(s) 385
Kzo9I GATC 2 cut(s) 180, 687
LweI GCATC 2 cut(s) 520, 775
MaeI CTAG 2 cut(s) 374, 579
MaeII ACGT 1 cut(s) 318
MaeIII GTNAC 1 cut(s) 919
MalI GATC 2 cut(s) 182, 689
MboI GATC 2 cut(s) 180, 687
MboII GAAGA 9 cut(s) 16, 33, 40, 43, 98, 205, 362, 596, 889
MhlI GDGCHC 1 cut(s) 130
MluCI AATT 6 cut(s) 163, 213, 716, 738, 808, 944
MlyI GAGTC 3 cut(s) 554, 689, 874
MnlI CCTC 5 cut(s) 74, 178, 199, 350, 724
MroXI GAANNNNTTC 2 cut(s) 782, 911
MseI TTAA 1 cut(s) 278
MspI CCGG 3 cut(s) 22, 464, 851
Mva1269I GAATGC 1 cut(s) 231
MwoI GCNNNNNNNGC 1 cut(s) 22
NdeII GATC 2 cut(s) 180, 687
NlaIII CATG 4 cut(s) 615, 625, 646, 842
NlaIV GGNNCC 2 cut(s) 627, 727
NmuCI GTSAC 1 cut(s) 919
NspI RCATGY 1 cut(s) 646
PagI TCATGA 1 cut(s) 838
PciI ACATGT 1 cut(s) 642
PctI GAATGC 1 cut(s) 231
PdmI GAANNNNTTC 2 cut(s) 782, 911
PfeI GAWTC 4 cut(s) 96, 295, 607, 895
PleI GAGTC 3 cut(s) 554, 689, 874
PpsI GAGTC 3 cut(s) 554, 689, 874
PscI ACATGT 1 cut(s) 642
PspN4I GGNNCC 2 cut(s) 627, 727
PspPI GGNCC 2 cut(s) 625, 725
RsaI GTAC 6 cut(s) 93, 222, 363, 593, 806, 835
RsaNI GTAC 6 cut(s) 92, 221, 362, 592, 805, 834
SalI GTCGAC 1 cut(s) 557
SaqAI TTAA 1 cut(s) 278
Sau3AI GATC 2 cut(s) 180, 687
Sau96I GGNCC 2 cut(s) 625, 725
SchI GAGTC 3 cut(s) 554, 689, 874
SduI GDGCHC 1 cut(s) 130
SfaNI GCATC 2 cut(s) 520, 775
SinI GGWCC 1 cut(s) 625
SmlI CTYRAG 2 cut(s) 169, 932
SmoI CTYRAG 2 cut(s) 169, 932
Sse9I AATT 6 cut(s) 163, 213, 716, 738, 808, 944
SspMI CTAG 2 cut(s) 374, 579
StyI CCWWGG 1 cut(s) 72
TaaI ACNGT 1 cut(s) 30
TaiI ACGT 1 cut(s) 321
TaqI TCGA 4 cut(s) 183, 408, 558, 769
TasI AATT 6 cut(s) 163, 213, 716, 738, 808, 944
TatI WGTACW 4 cut(s) 220, 591, 804, 833
TfiI GAWTC 4 cut(s) 96, 295, 607, 895
Tru1I TTAA 1 cut(s) 278
Tru9I TTAA 1 cut(s) 278
TscAI CASTG 1 cut(s) 928
TseFI GTSAC 1 cut(s) 919
Tsp45I GTSAC 1 cut(s) 919
TspDTI ATGAA 8 cut(s) 17, 22, 43, 189, 225, 440, 530, 857
TspRI CASTG 1 cut(s) 928
VpaK11BI GGWCC 1 cut(s) 625
XagI CCTNNNNNAGG 1 cut(s) 344
XapI RAATTY 2 cut(s) 213, 738
XceI RCATGY 1 cut(s) 646
XmiI GTMKAC 1 cut(s) 558
XmnI GAANNNNTTC 2 cut(s) 782, 911
XspI CTAG 2 cut(s) 374, 579
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.