Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013420.1

Orthogroup ID

OG0015619

Physical Location & Seq

Genomic Coordinates Reverse (-)

18017 .. 20349

Gene Structure 2333 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013420.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1269 bp

atgcttctgggttcaggtagaaatgaaggaacgattatgagagacaatggcggtgttttaaatttggagaatgtgtttgagtgtttgattgagaatcaggcaaacggaaatctgcaaatttcaggggaagcaaagctagaccgagtgattgagaaacagagggaggagtatgcaacacttgagaaaaggcataagtttgagatggagaaaatgctaaaagttgagaatgagtttgcagccctcaagagaaaacaccagcttcagctggaggaaaaagtcaaggttgagaatgagctgaaggcttgccgggtagagattgaggggctcaaagttgagaatgaggtgaagaagttgaaggaagtgctaaaggcagtcgaggaaaatcataagagcgagtataaagcactcgagcaaaagcaccaatctcaccttctgggagttgagaatgagttaaggcactgcaaagccgagcttcagggaataaaggaggagctaagtacctcagatgagaagtatgagaagcttctggaggaggtgaataagcacaggaaagaggaggatgaagtggtcaatttcgatccccaaaggcagagcaaggaggtggagagtgagcctaatgtggtattggaggacgaaatctctcggttagataagtttaggaatgcaaagcatcttggttcaaaaaacatggataagagaagcaaaaatagtggaatgccagatggtagtagaaaacagaagtgtattgtaacccctaaccatgtcataaatgtagagaatgatttttgtggttctgtgccagcgagtacttcccctcgaggaaacagtgttcgaaattcaggtacttctaaatcttcaaatgcagacaccattctgcttagcgatagcgatgatgattgtgctcctgcaaaacagaaaaattttgggctcaaaagaaaacgagcttcatctccaaatgctagtaacaataacaatggtggtcacaatttcaaacgagagagtttcccgacctctgagaataagcaaagccggatgctgggccgttgtgactctctagttggtggctatggaatacaaaataacccaccgaatcgtgaccaagagaccttaagaccatctgaagaaaaagtaggggaacagaaacctcctgcaaaggtgaatggcgagtctgattccagttctgcatctatgttcagttctgatgattcggaggatgacgatgacatcaatcttgactcaatgatgctgttcacaacaaacagatcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

422

Amino Acids

47.58

Weight (kDa)

5.69

Isoelectric Point (pI)

54.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015619)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g04040 FvH4_5g04040 FvH4_5g04040
rosa_chinensis	RchiOBHm_Chr7g0195481
rosa_laevigata	RLG00000004117
rosa_multiflora	Rmu_sc0013420.1_g000004 Rmu_sc0019107.1_g000002
rosa_roxburghii	Rroxscaffold_3G00260440
rosa_rugosa	Rorug07G0023700 Rorug07G0023700 Rorug07G0023800
rosa_samantha	Rh7AG151100 Rh7BG152800 Rh7CG156300 Rh7DG152100
rosa_wichuraiana	Rw7G012900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AbsI	CCTCGAGG	1 cut(s)	816
AciI	CCGC	1 cut(s)	51
AclWI	GGATC	1 cut(s)	572
AcsI	RAATTY	4 cut(s)	61, 117, 835, 919
AcuI	CTGAAG	4 cut(s)	245, 317, 458, 1140
AfaI	GTAC	3 cut(s)	499, 808, 844
AfiI	CCNNNNNNNGG	1 cut(s)	1036
AflII	CTTAAG	1 cut(s)	1108
AgsI	TTSAA	4 cut(s)	355, 681, 858, 991
AjuI	GAANNNNNNNTTGG	2 cut(s)	414, 446
AloI	GAACNNNNNNTCC	2 cut(s)	813, 845
AluBI	AGCT	8 cut(s)	136, 259, 265, 295, 472, 493, 523, 944
AluI	AGCT	8 cut(s)	136, 259, 265, 295, 472, 493, 523, 944
Alw21I	GWGCWC	1 cut(s)	904
Alw26I	GTCTC	2 cut(s)	36, 1097
AlwI	GGATC	1 cut(s)	572
Ama87I	CYCGRG	2 cut(s)	407, 816
AoxI	GGCC	1 cut(s)	1039
ApeKI	GCWGC	1 cut(s)	236
ApoI	RAATTY	4 cut(s)	61, 117, 835, 919
AspS9I	GGNCC	1 cut(s)	1039
AsuC2I	CCSGG	1 cut(s)	308
AsuHPI	GGTGA	4 cut(s)	355, 419, 547, 1168
AsuII	TTCGAA	1 cut(s)	832
AvaI	CYCGRG	2 cut(s)	407, 816
BanII	GRGCYC	2 cut(s)	327, 930
Bbv12I	GWGCWC	1 cut(s)	904
BbvI	GCAGC	1 cut(s)	248
BccI	CCATC	3 cut(s)	196, 716, 1123
BceAI	ACGGC	1 cut(s)	1026
BcnI	CCSGG	1 cut(s)	308
BcoDI	GTCTC	2 cut(s)	36, 1097
BfaI	CTAG	3 cut(s)	137, 960, 1055
BfrI	CTTAAG	1 cut(s)	1108
BisI	GCNGC	1 cut(s)	237
BlpI	GCTNAGC	1 cut(s)	878
BlsI	GCNGC	1 cut(s)	238
BmcAI	AGTACT	1 cut(s)	808
Bme1390I	CCNGG	1 cut(s)	308
BmeT110I	CYCGRG	2 cut(s)	407, 816
BmgT120I	GGNCC	1 cut(s)	1039
BmrFI	CCNGG	1 cut(s)	308
BmsI	GCATC	4 cut(s)	679, 1023, 1193, 1233
BpmI	CTGGAG	2 cut(s)	287, 548
Bpu1102I	GCTNAGC	1 cut(s)	878
Bpu14I	TTCGAA	1 cut(s)	832
BpuEI	CTTGAG	2 cut(s)	200, 227
BpuMI	CCSGG	1 cut(s)	308
BsaI	GGTCTC	1 cut(s)	1097
BsaXI	ACNNNNNCTCC	2 cut(s)	59, 89
Bsc4I	CCNNNNNNNGG	1 cut(s)	1036
Bse1I	ACTGG	1 cut(s)	1176
BseGI	GGATG	3 cut(s)	565, 1038, 1219
BseLI	CCNNNNNNNGG	1 cut(s)	1036
BseMII	CTCAG	2 cut(s)	516, 1005
BseNI	ACTGG	1 cut(s)	1176
BseRI	GAGGAG	4 cut(s)	179, 503, 545, 569
BseXI	GCAGC	1 cut(s)	248
BseYI	CCCAGC	1 cut(s)	1036
BshFI	GGCC	1 cut(s)	1041
BsiHKAI	GWGCWC	1 cut(s)	904
BsiHKCI	CYCGRG	2 cut(s)	407, 816
BsiSI	CCGG	2 cut(s)	307, 1030
BslI	CCNNNNNNNGG	1 cut(s)	1036
BsmAI	GTCTC	2 cut(s)	36, 1097
BsmI	GAATGC	2 cut(s)	667, 720
BsnI	GGCC	1 cut(s)	1041
Bso31I	GGTCTC	1 cut(s)	1097
BsoBI	CYCGRG	2 cut(s)	407, 816
Bsp119I	TTCGAA	1 cut(s)	832
Bsp1286I	GDGCHC	3 cut(s)	327, 904, 930
Bsp143I	GATC	2 cut(s)	577, 1262
Bsp1720I	GCTNAGC	1 cut(s)	878
BspACI	CCGC	1 cut(s)	51
BspANI	GGCC	1 cut(s)	1041
BspCNI	CTCAG	2 cut(s)	515, 1006
BspHI	TCATGA	1 cut(s)	1265
BspPI	GGATC	1 cut(s)	572
BspT104I	TTCGAA	1 cut(s)	832
BspTI	CTTAAG	1 cut(s)	1108
BspTNI	GGTCTC	1 cut(s)	1097
BsrI	ACTGG	1 cut(s)	1176
BssMI	GATC	2 cut(s)	577, 1262
Bst4CI	ACNGT	1 cut(s)	827
BstAFI	CTTAAG	1 cut(s)	1108
BstBI	TTCGAA	1 cut(s)	832
BstC8I	GCNNGC	2 cut(s)	304, 801
BstDEI	CTNAG	4 cut(s)	494, 502, 878, 1014
BstF5I	GGATG	3 cut(s)	565, 1038, 1219
BstKTI	GATC	2 cut(s)	580, 1265
BstMAI	GTCTC	2 cut(s)	36, 1097
BstMBI	GATC	2 cut(s)	577, 1262
BstSCI	CCNGG	1 cut(s)	306
BstV1I	GCAGC	1 cut(s)	248
BsuRI	GGCC	1 cut(s)	1041
BtgZI	GCGATG	1 cut(s)	903
BtsCI	GGATG	3 cut(s)	565, 1038, 1219
BtsI	GCAGTG	1 cut(s)	457
BtsIMutI	CAGTG	2 cut(s)	457, 832
Cac8I	GCNNGC	2 cut(s)	304, 801
CciI	TCATGA	1 cut(s)	1265
Cfr13I	GGNCC	1 cut(s)	1039
Csp6I	GTAC	3 cut(s)	498, 807, 843
CspCI	CAANNNNNGTGG	2 cut(s)	691, 726
CviAII	CATG	3 cut(s)	688, 761, 1266
CviQI	GTAC	3 cut(s)	498, 807, 843
DdeI	CTNAG	4 cut(s)	494, 502, 878, 1014
DpnI	GATC	2 cut(s)	579, 1264
DpnII	GATC	2 cut(s)	577, 1262
DraI	TTTAAA	1 cut(s)	60
Eco24I	GRGCYC	2 cut(s)	327, 930
Eco31I	GGTCTC	1 cut(s)	1097
Eco57I	CTGAAG	4 cut(s)	245, 317, 458, 1140
Eco88I	CYCGRG	2 cut(s)	407, 816
EcoT38I	GRGCYC	2 cut(s)	327, 930
FaeI	CATG	3 cut(s)	691, 764, 1269
FalI	AAGNNNNNCTT	2 cut(s)	456, 488
FatI	CATG	3 cut(s)	687, 760, 1265
Fnu4HI	GCNGC	1 cut(s)	237
FokI	GGATG	3 cut(s)	572, 1045, 1226
FriOI	GRGCYC	2 cut(s)	327, 930
Fsp4HI	GCNGC	1 cut(s)	237
FspBI	CTAG	3 cut(s)	137, 960, 1055
GluI	GCNGC	1 cut(s)	237
GsaI	CCCAGC	1 cut(s)	1040
GsuI	CTGGAG	2 cut(s)	287, 548
HaeIII	GGCC	1 cut(s)	1041
HapII	CCGG	2 cut(s)	307, 1030
Hin1II	CATG	3 cut(s)	691, 764, 1269
HindIII	AAGCTT	1 cut(s)	521
HinfI	GANTC	7 cut(s)	94, 1049, 1090, 1166, 1172, 1205, 1235
HpaII	CCGG	2 cut(s)	307, 1030
HphI	GGTGA	4 cut(s)	355, 419, 547, 1168
Hpy166II	GTNNAC	1 cut(s)	1251
Hpy188I	TCNGA	6 cut(s)	505, 1015, 1120, 1171, 1201, 1210
Hpy188III	TCNNGA	6 cut(s)	244, 527, 1006, 1094, 1232, 1266
Hpy8I	GTNNAC	1 cut(s)	1251
HpyAV	CCTTC	4 cut(s)	20, 292, 349, 440
HpyCH4III	ACNGT	1 cut(s)	827
HpyCH4V	TGCA	9 cut(s)	115, 173, 236, 462, 665, 863, 908, 1151, 1184
HpyF3I	CTNAG	4 cut(s)	494, 502, 878, 1014
Hsp92II	CATG	3 cut(s)	691, 764, 1269
Kzo9I	GATC	2 cut(s)	577, 1262
LmnI	GCTCC	2 cut(s)	490, 907
Lsp1109I	GCAGC	1 cut(s)	248
LweI	GCATC	4 cut(s)	679, 1023, 1193, 1233
MaeI	CTAG	3 cut(s)	137, 960, 1055
MaeIII	GTNAC	5 cut(s)	748, 962, 980, 1046, 1094
MalI	GATC	2 cut(s)	579, 1264
MboI	GATC	2 cut(s)	577, 1262
MboII	GAAGA	3 cut(s)	358, 846, 1133
MhlI	GDGCHC	3 cut(s)	327, 904, 930
MluCI	AATT	6 cut(s)	61, 117, 571, 835, 919, 985
MlyI	GAGTC	3 cut(s)	1043, 1175, 1229
MseI	TTAA	3 cut(s)	59, 452, 1109
MspA1I	CMGCKG	1 cut(s)	265
MspCI	CTTAAG	1 cut(s)	1108
MspI	CCGG	2 cut(s)	307, 1030
MspR9I	CCNGG	1 cut(s)	308
Mva1269I	GAATGC	2 cut(s)	667, 720
NciI	CCSGG	1 cut(s)	308
NdeII	GATC	2 cut(s)	577, 1262
NlaIII	CATG	3 cut(s)	691, 764, 1269
NmeAIII	GCCGAG	1 cut(s)	493
NmuCI	GTSAC	3 cut(s)	980, 1046, 1094
NspV	TTCGAA	1 cut(s)	832
PaeR7I	CTCGAG	2 cut(s)	407, 816
PagI	TCATGA	1 cut(s)	1265
PctI	GAATGC	2 cut(s)	667, 720
PfeI	GAWTC	4 cut(s)	94, 1090, 1172, 1205
PkrI	GCNGC	1 cut(s)	238
PleI	GAGTC	3 cut(s)	1043, 1174, 1229
PpsI	GAGTC	3 cut(s)	1043, 1174, 1229
PspFI	CCCAGC	1 cut(s)	1036
PspPI	GGNCC	1 cut(s)	1039
PspXI	VCTCGAGB	2 cut(s)	407, 816
PvuII	CAGCTG	1 cut(s)	265
RsaI	GTAC	3 cut(s)	499, 808, 844
RsaNI	GTAC	3 cut(s)	498, 807, 843
SaqAI	TTAA	3 cut(s)	59, 452, 1109
SatI	GCNGC	1 cut(s)	237
Sau3AI	GATC	2 cut(s)	577, 1262
Sau96I	GGNCC	1 cut(s)	1039
ScaI	AGTACT	1 cut(s)	808
SchI	GAGTC	3 cut(s)	1043, 1175, 1229
ScrFI	CCNGG	1 cut(s)	308
SduI	GDGCHC	3 cut(s)	327, 904, 930
SfaNI	GCATC	4 cut(s)	679, 1023, 1193, 1233
Sfr274I	CTCGAG	2 cut(s)	407, 816
SfuI	TTCGAA	1 cut(s)	832
SlaI	CTCGAG	2 cut(s)	407, 816
SmlI	CTYRAG	5 cut(s)	179, 242, 407, 816, 1108
SmoI	CTYRAG	5 cut(s)	179, 242, 407, 816, 1108
Sse9I	AATT	6 cut(s)	61, 117, 571, 835, 919, 985
SsiI	CCGC	1 cut(s)	51
SspMI	CTAG	3 cut(s)	137, 960, 1055
StyD4I	CCNGG	1 cut(s)	306
TaaI	ACNGT	1 cut(s)	827
TaqI	TCGA	5 cut(s)	375, 408, 576, 817, 832
TaqII	GACCGA	1 cut(s)	156
TasI	AATT	6 cut(s)	61, 117, 571, 835, 919, 985
TatI	WGTACW	1 cut(s)	806
TfiI	GAWTC	4 cut(s)	94, 1090, 1172, 1205
Tru1I	TTAA	3 cut(s)	59, 452, 1109
Tru9I	TTAA	3 cut(s)	59, 452, 1109
TscAI	CASTG	2 cut(s)	464, 832
TseFI	GTSAC	3 cut(s)	980, 1046, 1094
TseI	GCWGC	1 cut(s)	236
Tsp45I	GTSAC	3 cut(s)	980, 1046, 1094
TspDTI	ATGAA	3 cut(s)	39, 576, 936
TspGWI	ACGGA	1 cut(s)	120
TspRI	CASTG	2 cut(s)	464, 832
Vha464I	CTTAAG	1 cut(s)	1108
XapI	RAATTY	4 cut(s)	61, 117, 835, 919
XhoI	CTCGAG	2 cut(s)	407, 816
XspI	CTAG	3 cut(s)	137, 960, 1055
ZrmI	AGTACT	1 cut(s)	808

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.