Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014889.1

Orthogroup ID

OG0004121

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1201

Gene Structure 1201 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014889.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 727 bp

ccctatcgtttgcagataccgtttgagggctaaggttgacattgagaatgtggcagacgagttacattgctggcagcgttacgggggaaagctatgtaagaaggactcctctgtagaagaaccagaagctgctagtgttggctggggtgctggtgttgatcgcttaggcatgtcaacttcacgtggagagccttgtggatggcagtggtttaaggatccgagattggattgccttggtttcagggggatcttcccgtctaatacaacaccacctttggttgaagctgacaaagaaacagatgaacaaaactaccttctatggagaatagaaaatggtgttgcagaaggatcaaccgagatctctaaaggtgaggcaattcctctagaatataacctggtggctctaaatgcaattagctttgacaaagggtgttatgtgggtcaagagcttgttgctcgaacacaccacagaggggtcattcgcaaacgcctgcttcctctaaaatttctcaaggatagcggagaagagcagaaggttgcccctggctctgaagtgattgatagtgtttctgacaagaaaattggtactgtcacaactcaacttggatgtcgtggacttggtgtcttgcgtttggatgaagcatttaaaggatcaagtacgctaaccatacgaagccaggacgatgtgaaggtcgagcctattagacctggttgcccctggctctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005759 GO:0006790 GO:0008150 GO:0008152 GO:0009987 GO:0016043 GO:0016226 GO:0022607 GO:0031163 GO:0031974 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044085 GO:0044237 GO:0044422 GO:0044424 GO:0044429 GO:0044444 GO:0044446 GO:0044464 GO:0051186 GO:0070013 GO:0071840

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GCV_T_C

Protein Analysis

241

Amino Acids

26.7

Weight (kDa)

6.05

Isoelectric Point (pI)

30.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004121)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G12130
fragaria_vesca	FvH4_5g00670 FvH4_5g00670 FvH4_5g00670 FvH4_5g00670 FvH4_5g00670
malus_domestica	MD04G1079500.v1.1
prunus_persica	Prupe.5G079500_v2.0.a1 Prupe.5G079500_v2.0.a1
pyrus_communis	pycom04g07160
rosa_chinensis	RchiOBHm_Chr4g0419741 RchiOBHm_Chr7g0201591
rosa_laevigata	RLG00000003663 RLG00000007800
rosa_multiflora	Rmu_sc0014889.1_g000001 Rmu_sc0016868.1_g000005 Rmu_sc0016868.1_g000007
rosa_roxburghii	Rroxscaffold_3G00255220 Rroxscaffold_5G00362570
rosa_rugosa	Rorug04G0160100 Rorug04G0160200 Rorug04G0160300 Rorug07G0064900 Rorug07G0065000
rosa_samantha	Rh4BG223300 Rh4CG234600 Rh4DG220300 Rh7AG191500 Rh7BG193800 Rh7CG202900 Rh7DG196800
rosa_wichuraiana	Rw4G019050 Rw7G016790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	520
AclWI	GGATC	5 cut(s)	210, 223, 255, 356, 659
AcsI	RAATTY	1 cut(s)	504
AcuI	CTGAAG	1 cut(s)	571
AcvI	CACGTG	1 cut(s)	183
AfaI	GTAC	2 cut(s)	587, 659
AfiI	CCNNNNNNNGG	2 cut(s)	26, 473
AgsI	TTSAA	1 cut(s)	282
AhdI	GACNNNNNGTC	1 cut(s)	621
AjnI	CCWGG	5 cut(s)	394, 542, 676, 707, 717
AluBI	AGCT	5 cut(s)	92, 129, 285, 418, 449
AluI	AGCT	5 cut(s)	92, 129, 285, 418, 449
AlwI	GGATC	5 cut(s)	210, 223, 255, 356, 659
AlwNI	CAGNNNCTG	1 cut(s)	129
ApeKI	GCWGC	2 cut(s)	74, 129
ApoI	RAATTY	1 cut(s)	504
AsuHPI	GGTGA	1 cut(s)	381
BamHI	GGATCC	1 cut(s)	215
BbrPI	CACGTG	1 cut(s)	183
BbvI	GCAGC	2 cut(s)	86, 116
BccI	CCATC	1 cut(s)	193
BciT130I	CCWGG	5 cut(s)	396, 544, 678, 709, 719
BfaI	CTAG	2 cut(s)	133, 384
BfmI	CTRYAG	1 cut(s)	112
BglII	AGATCT	1 cut(s)	358
BisI	GCNGC	2 cut(s)	75, 130
BlsI	GCNGC	2 cut(s)	76, 131
Bme1390I	CCNGG	5 cut(s)	396, 544, 678, 709, 719
BmeRI	GACNNNNNGTC	1 cut(s)	621
BmiI	GGNNCC	1 cut(s)	217
BmrFI	CCNGG	5 cut(s)	396, 544, 678, 709, 719
Bpu10I	CCTNAGC	2 cut(s)	31, 164
BpuEI	CTTGAG	1 cut(s)	495
BsaAI	YACGTR	1 cut(s)	183
BsaJI	CCNNGG	3 cut(s)	233, 542, 717
Bsc4I	CCNNNNNNNGG	2 cut(s)	26, 473
Bse3DI	GCAATG	1 cut(s)	65
BseBI	CCWGG	5 cut(s)	396, 544, 678, 709, 719
BseDI	CCNNGG	3 cut(s)	233, 542, 717
BseGI	GGATG	3 cut(s)	204, 612, 641
BseLI	CCNNNNNNNGG	2 cut(s)	26, 473
BseMI	GCAATG	1 cut(s)	65
BseRI	GAGGAG	1 cut(s)	98
BseXI	GCAGC	2 cut(s)	86, 116
BseYI	CCCAGC	1 cut(s)	142
BslI	CCNNNNNNNGG	2 cut(s)	26, 473
Bsp143I	GATC	6 cut(s)	158, 215, 247, 348, 358, 651
BspACI	CCGC	1 cut(s)	520
BspLI	GGNNCC	1 cut(s)	217
BspPI	GGATC	5 cut(s)	210, 223, 255, 356, 659
BspQI	GCTCTTC	1 cut(s)	520
BsrDI	GCAATG	1 cut(s)	65
BssECI	CCNNGG	3 cut(s)	233, 542, 717
BssMI	GATC	6 cut(s)	158, 215, 247, 348, 358, 651
BssT1I	CCWWGG	1 cut(s)	233
Bst2UI	CCWGG	5 cut(s)	396, 544, 678, 709, 719
Bst4CI	ACNGT	2 cut(s)	21, 590
Bst6I	CTCTTC	1 cut(s)	520
BstBAI	YACGTR	1 cut(s)	183
BstC8I	GCNNGC	2 cut(s)	72, 492
BstDEI	CTNAG	2 cut(s)	31, 164
BstF5I	GGATG	3 cut(s)	204, 612, 641
BstKTI	GATC	6 cut(s)	161, 218, 250, 351, 361, 654
BstMBI	GATC	6 cut(s)	158, 215, 247, 348, 358, 651
BstMWI	GCNNNNNNNGC	1 cut(s)	408
BstNI	CCWGG	5 cut(s)	396, 544, 678, 709, 719
BstNSI	RCATGY	1 cut(s)	173
BstSCI	CCNGG	5 cut(s)	394, 542, 676, 707, 717
BstSFI	CTRYAG	1 cut(s)	112
BstV1I	GCAGC	2 cut(s)	86, 116
BstX2I	RGATCY	3 cut(s)	215, 247, 358
BstYI	RGATCY	3 cut(s)	215, 247, 358
BtsCI	GGATG	3 cut(s)	204, 612, 641
BtsI	GCAGTG	1 cut(s)	210
BtsIMutI	CAGTG	1 cut(s)	210
Cac8I	GCNNGC	2 cut(s)	72, 492
CaiI	CAGNNNCTG	1 cut(s)	129
CsiI	ACCWGGT	2 cut(s)	394, 707
Csp6I	GTAC	2 cut(s)	586, 658
CviAII	CATG	1 cut(s)	170
CviQI	GTAC	2 cut(s)	586, 658
DdeI	CTNAG	2 cut(s)	31, 164
DpnI	GATC	6 cut(s)	160, 217, 249, 350, 360, 653
DpnII	GATC	6 cut(s)	158, 215, 247, 348, 358, 651
DraI	TTTAAA	1 cut(s)	647
DriI	GACNNNNNGTC	1 cut(s)	621
Eam1104I	CTCTTC	1 cut(s)	520
Eam1105I	GACNNNNNGTC	1 cut(s)	621
EarI	CTCTTC	1 cut(s)	520
Eco130I	CCWWGG	1 cut(s)	233
Eco57I	CTGAAG	1 cut(s)	571
Eco72I	CACGTG	1 cut(s)	183
EcoRII	CCWGG	5 cut(s)	394, 542, 676, 707, 717
EcoT14I	CCWWGG	1 cut(s)	233
ErhI	CCWWGG	1 cut(s)	233
FaeI	CATG	1 cut(s)	173
FaiI	YATR	6 cut(s)	95, 171, 320, 391, 436, 669
FatI	CATG	1 cut(s)	169
Fnu4HI	GCNGC	2 cut(s)	75, 130
FokI	GGATG	3 cut(s)	211, 619, 648
Fsp4HI	GCNGC	2 cut(s)	75, 130
FspBI	CTAG	2 cut(s)	133, 384
GluI	GCNGC	2 cut(s)	75, 130
GsaI	CCCAGC	1 cut(s)	146
Hin1II	CATG	1 cut(s)	173
HincII	GTYRAC	2 cut(s)	38, 175
HindII	GTYRAC	2 cut(s)	38, 175
HinfI	GANTC	1 cut(s)	105
HphI	GGTGA	1 cut(s)	381
Hpy166II	GTNNAC	3 cut(s)	38, 175, 615
Hpy188I	TCNGA	4 cut(s)	220, 551, 572, 726
Hpy188III	TCNNGA	2 cut(s)	384, 444
Hpy8I	GTNNAC	3 cut(s)	38, 175, 615
HpyAV	CCTTC	5 cut(s)	95, 324, 339, 527, 683
HpyCH4III	ACNGT	2 cut(s)	21, 590
HpyCH4IV	ACGT	1 cut(s)	182
HpyCH4V	TGCA	3 cut(s)	13, 342, 411
HpyF10VI	GCNNNNNNNGC	1 cut(s)	408
HpyF3I	CTNAG	2 cut(s)	31, 164
HpySE526I	ACGT	1 cut(s)	182
Hsp92II	CATG	1 cut(s)	173
Kzo9I	GATC	6 cut(s)	158, 215, 247, 348, 358, 651
LguI	GCTCTTC	1 cut(s)	520
Lsp1109I	GCAGC	2 cut(s)	86, 116
MabI	ACCWGGT	2 cut(s)	394, 707
MaeI	CTAG	2 cut(s)	133, 384
MaeII	ACGT	1 cut(s)	182
MaeIII	GTNAC	3 cut(s)	61, 78, 590
MalI	GATC	6 cut(s)	160, 217, 249, 350, 360, 653
MboI	GATC	6 cut(s)	158, 215, 247, 348, 358, 651
MboII	GAAGA	3 cut(s)	129, 242, 537
MflI	RGATCY	3 cut(s)	215, 247, 358
MluCI	AATT	4 cut(s)	376, 412, 504, 580
MlyI	GAGTC	1 cut(s)	99
MnlI	CCTC	6 cut(s)	19, 119, 365, 391, 465, 508
MseI	TTAA	2 cut(s)	211, 646
MspR9I	CCNGG	5 cut(s)	396, 544, 678, 709, 719
MvaI	CCWGG	5 cut(s)	396, 544, 678, 709, 719
MwoI	GCNNNNNNNGC	1 cut(s)	408
NdeII	GATC	6 cut(s)	158, 215, 247, 348, 358, 651
NlaIII	CATG	1 cut(s)	173
NlaIV	GGNNCC	1 cut(s)	217
NmuCI	GTSAC	1 cut(s)	590
NspI	RCATGY	1 cut(s)	173
PciSI	GCTCTTC	1 cut(s)	520
PkrI	GCNGC	2 cut(s)	76, 131
PleI	GAGTC	1 cut(s)	99
PmaCI	CACGTG	1 cut(s)	183
PmlI	CACGTG	1 cut(s)	183
PpsI	GAGTC	1 cut(s)	99
Ppu21I	YACGTR	1 cut(s)	183
Psp6I	CCWGG	5 cut(s)	394, 542, 676, 707, 717
PspCI	CACGTG	1 cut(s)	183
PspFI	CCCAGC	1 cut(s)	142
PspGI	CCWGG	5 cut(s)	394, 542, 676, 707, 717
PspN4I	GGNNCC	1 cut(s)	217
PstNI	CAGNNNCTG	1 cut(s)	129
PsuI	RGATCY	3 cut(s)	215, 247, 358
RsaI	GTAC	2 cut(s)	587, 659
RsaNI	GTAC	2 cut(s)	586, 658
SapI	GCTCTTC	1 cut(s)	520
SaqAI	TTAA	2 cut(s)	211, 646
SatI	GCNGC	2 cut(s)	75, 130
Sau3AI	GATC	6 cut(s)	158, 215, 247, 348, 358, 651
SchI	GAGTC	1 cut(s)	99
ScrFI	CCNGG	5 cut(s)	396, 544, 678, 709, 719
SexAI	ACCWGGT	2 cut(s)	394, 707
SfcI	CTRYAG	1 cut(s)	112
SmlI	CTYRAG	1 cut(s)	510
SmoI	CTYRAG	1 cut(s)	510
Sse9I	AATT	4 cut(s)	376, 412, 504, 580
SsiI	CCGC	1 cut(s)	520
SspMI	CTAG	2 cut(s)	133, 384
StyD4I	CCNGG	5 cut(s)	394, 542, 676, 707, 717
StyI	CCWWGG	1 cut(s)	233
TaaI	ACNGT	2 cut(s)	21, 590
TaiI	ACGT	1 cut(s)	185
TaqI	TCGA	2 cut(s)	458, 694
TasI	AATT	4 cut(s)	376, 412, 504, 580
Tru1I	TTAA	2 cut(s)	211, 646
Tru9I	TTAA	2 cut(s)	211, 646
TscAI	CASTG	1 cut(s)	210
TseFI	GTSAC	1 cut(s)	590
TseI	GCWGC	2 cut(s)	74, 129
Tsp45I	GTSAC	1 cut(s)	590
TspDTI	ATGAA	2 cut(s)	316, 652
TspRI	CASTG	1 cut(s)	210
XapI	RAATTY	1 cut(s)	504
XbaI	TCTAGA	1 cut(s)	383
XceI	RCATGY	1 cut(s)	173
XspI	CTAG	2 cut(s)	133, 384

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.