Rmu_sc0015477.1_g000001

Belongs to the oxygen-dependent FAD-linked oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015477.1
OG0018275
Physical Location & Seq
Forward (+)
1632 .. 3179
1548 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015477.1_g000001.1.cds

Sequence Viewer

Length: 1548 bp
atggcagcttcagatccagtccaagacaccttcctccaatgcctctccaatctttcccaatccccctctccaccaatctcatcagtcacctatttccccaccaacccttcatacacaccaatcttacattcctacataagaaaccttagattcacaacccctaaaaccccaaaaccctcattcattgtcactccaacccatgtttctcacatccaagcctcaatcctctgctccaaaatccataaccttcaagtcagaatccgcagcggtggtcatgactatgatggcctctcttacatctcagatgttgcattcatcattattgacatgttcaatcttcgatccataacagtcaacatagaagatgaaagtgcttgggtcgagtctggagctacactaggtgaagtttattacagaatagctgagcagagcaaaatacatggctacccagctggggtttgtcccacagtgggagtcggaggacacttgagtggaggtgggtatggaaatatgatgaggaaacatggcttatcagttgataacattcttgatgctcaaatagttgatgttaatggaagggttttggatagagagtcaatgggggaagacctcttttgggcgattagaggtggaggtggagctagttttggtgtcattgtttcttggaaaatcaaattggttcaagtcccagaagttgtcacagtttttagagttgagaggactttggagcaaggcgccaccgacattgttcatcaatggcagtatgtaggggatacaatagatgatgatcttttcattagggtggttgtgatgccagtcaatagaaaaactcagacagtgaaagctaaatttgttgctttgtatttaggaaaagcagaaaagcttgaagctttgatgggtgagaggtttccccaattgggtttgaagcatgaggactatgtcgaaatgggttggattgaatcggttctgtattggtctaactacccaattggaacttctgcagatatactgcttgaaagaatacctcagtcagaaaagttcttgaagaagaaatctgactacatccaagaaccaatgtcaaaggctggacttgaaggactgtggaacaagatgatggagctgaaaaagccagtactaacattcaatccttatggtgggaaaatgagcgaaattccggagcttgacaccccattcccacatagagcaggaaatgtgtacaaaattcagtactcggtgaattggaaagaggaaggtgtagaggctgaagataaacatcttgatctgataagaaggctttatgtgcatatgacaccttatgtgtcaaagtcaccaaggtgttcatatctaaattacagagatgttgatttggggactaatggaaatggcaatgtgagctactcagaagctagtgtttgggggaccaagtacttcaagggaaactttgagaggttggtacaagtgaagactgctgttgatccaggaaactttttcaggtatgaacaaagtatcccacctcttacggcttggaatggtaaaatggcagagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BBE FAD_binding_4

Protein Analysis

515

Amino Acids

57.89

Weight (kDa)

6.38

Isoelectric Point (pI)

35.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018275)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g11010
malus_domestica MD05G1267500.v1.1
prunus_persica Prupe.4G098400_v2.0.a1
pyrus_communis pycom05g25050
rosa_chinensis RchiOBHm_Chr5g0017721
rosa_laevigata RLG00000032309
rosa_multiflora Rmu_sc0015477.1_g000001
rosa_roxburghii Rroxscaffold_1G00059770
rosa_rugosa Rorug05G0037500
rosa_wichuraiana Rw5G011380

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 734
AccIII TCCGGA 1 cut(s) 1174
AciI CCGC 2 cut(s) 262, 267
AclWI GGATC 3 cut(s) 8, 336, 1469
AcsI RAATTY 3 cut(s) 848, 1170, 1221
AcuI CTGAAG 1 cut(s) 1284
AcyI GRCGYC 1 cut(s) 735
AdeI CACNNNGTG 1 cut(s) 401
AfaI GTAC 5 cut(s) 1134, 1217, 1229, 1427, 1455
AfiI CCNNNNNNNGG 5 cut(s) 454, 470, 616, 917, 1154
AflIII ACRYGT 1 cut(s) 327
AjnI CCWGG 1 cut(s) 1477
AjuI GAANNNNNNNTTGG 8 cut(s) 112, 144, 187, 219, 659, 691, 979, 1011
AleI CACNNNNGTG 2 cut(s) 489, 1333
AloI GAACNNNNNNTCC 2 cut(s) 1491, 1523
AlwI GGATC 3 cut(s) 8, 336, 1469
Aor13HI TCCGGA 1 cut(s) 1174
AoxI GGCC 1 cut(s) 286
ApeKI GCWGC 2 cut(s) 5, 264
ApoI RAATTY 3 cut(s) 848, 1170, 1221
Asp700I GAANNNNTTC 1 cut(s) 963
AspLEI GCGC 1 cut(s) 737
AspS9I GGNCC 1 cut(s) 1419
AsuHPI GGTGA 5 cut(s) 79, 413, 911, 1246, 1320
AvaII GGWCC 1 cut(s) 1419
BanI GGYRCC 1 cut(s) 734
BbsI GAAGAC 2 cut(s) 612, 1469
BbvI GCAGC 2 cut(s) 17, 276
BccI CCATC 3 cut(s) 278, 889, 1108
BceAI ACGGC 1 cut(s) 1536
BciT130I CCWGG 1 cut(s) 1479
BciVI GTATCC 2 cut(s) 766, 1517
BfaI CTAG 3 cut(s) 398, 642, 1407
BfmI CTRYAG 1 cut(s) 999
BfoI RGCGCY 1 cut(s) 738
BfuI GTATCC 2 cut(s) 766, 1517
BisI GCNGC 2 cut(s) 6, 265
BlpI GCTNAGC 1 cut(s) 423
BlsI GCNGC 2 cut(s) 7, 266
BmcAI AGTACT 3 cut(s) 1134, 1229, 1427
Bme1390I CCNGG 1 cut(s) 1479
Bme18I GGWCC 1 cut(s) 1419
BmgT120I GGNCC 1 cut(s) 1419
BmiI GGNNCC 2 cut(s) 736, 1420
BmrFI CCNGG 1 cut(s) 1479
BmsI GCATC 2 cut(s) 541, 801
BpiI GAAGAC 2 cut(s) 612, 1469
BpmI CTGGAG 1 cut(s) 408
Bpu1102I GCTNAGC 1 cut(s) 423
BpuEI CTTGAG 1 cut(s) 508
BsaBI GATNNNNATC 2 cut(s) 786, 1272
BsaHI GRCGYC 1 cut(s) 735
BsaJI CCNNGG 1 cut(s) 1331
BsaWI WCCGGW 1 cut(s) 1174
Bsc4I CCNNNNNNNGG 5 cut(s) 454, 470, 616, 917, 1154
Bse1I ACTGG 3 cut(s) 17, 815, 1130
Bse3DI GCAATG 1 cut(s) 1393
Bse8I GATNNNNATC 2 cut(s) 786, 1272
BseAI TCCGGA 1 cut(s) 1174
BseBI CCWGG 1 cut(s) 1479
BseDI CCNNGG 1 cut(s) 1331
BseGI GGATG 2 cut(s) 210, 1062
BseJI GATNNNNATC 2 cut(s) 786, 1272
BseLI CCNNNNNNNGG 5 cut(s) 454, 470, 616, 917, 1154
BseMI GCAATG 1 cut(s) 1393
BseMII CTCAG 5 cut(s) 315, 414, 845, 1040, 1413
BseNI ACTGG 3 cut(s) 17, 815, 1130
BseXI GCAGC 2 cut(s) 17, 276
BseYI CCCAGC 2 cut(s) 448, 452
BshFI GGCC 1 cut(s) 288
BshNI GGYRCC 1 cut(s) 734
BsiSI CCGG 1 cut(s) 1175
BslFI GGGAC 4 cut(s) 447, 671, 1384, 1432
BslI CCNNNNNNNGG 5 cut(s) 454, 470, 616, 917, 1154
BsmFI GGGAC 4 cut(s) 447, 671, 1384, 1432
BsmI GAATGC 1 cut(s) 311
BsnI GGCC 1 cut(s) 288
Bsp13I TCCGGA 1 cut(s) 1174
Bsp1407I TGTACA 1 cut(s) 1215
Bsp143I GATC 5 cut(s) 13, 341, 787, 1279, 1474
Bsp1720I GCTNAGC 1 cut(s) 423
BspACI CCGC 2 cut(s) 262, 267
BspANI GGCC 1 cut(s) 288
BspCNI CTCAG 5 cut(s) 314, 415, 844, 1039, 1412
BspEI TCCGGA 1 cut(s) 1174
BspHI TCATGA 1 cut(s) 274
BspLI GGNNCC 2 cut(s) 736, 1420
BspMAI CTGCAG 1 cut(s) 1003
BspPI GGATC 3 cut(s) 8, 336, 1469
BspT107I GGYRCC 1 cut(s) 734
BsrDI GCAATG 1 cut(s) 1393
BsrGI TGTACA 1 cut(s) 1215
BsrI ACTGG 3 cut(s) 17, 815, 1130
BssECI CCNNGG 1 cut(s) 1331
BssMI GATC 5 cut(s) 13, 341, 787, 1279, 1474
BssNI GRCGYC 1 cut(s) 735
BssT1I CCWWGG 1 cut(s) 1331
Bst2UI CCWGG 1 cut(s) 1479
Bst4CI ACNGT 5 cut(s) 352, 469, 703, 838, 1101
BstACI GRCGYC 1 cut(s) 735
BstAUI TGTACA 1 cut(s) 1215
BstDEI CTNAG 6 cut(s) 146, 301, 423, 831, 1026, 1399
BstF5I GGATG 2 cut(s) 210, 1062
BstH2I RGCGCY 1 cut(s) 738
BstHHI GCGC 1 cut(s) 737
BstKTI GATC 5 cut(s) 16, 344, 790, 1282, 1477
BstMBI GATC 5 cut(s) 13, 341, 787, 1279, 1474
BstMWI GCNNNNNNNGC 3 cut(s) 1126, 1300, 1392
BstNI CCWGG 1 cut(s) 1479
BstNSI RCATGY 1 cut(s) 331
BstSCI CCNGG 1 cut(s) 1477
BstSFI CTRYAG 1 cut(s) 999
BstV1I GCAGC 2 cut(s) 17, 276
BstV2I GAAGAC 2 cut(s) 612, 1469
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BsuI GTATCC 2 cut(s) 766, 1517
BsuRI GGCC 1 cut(s) 288
BtsCI GGATG 2 cut(s) 210, 1062
BtsIMutI CAGTG 2 cut(s) 474, 843
CciI TCATGA 1 cut(s) 274
CfoI GCGC 1 cut(s) 737
Cfr13I GGNCC 1 cut(s) 1419
Csp6I GTAC 5 cut(s) 1133, 1216, 1228, 1426, 1454
CspCI CAANNNNNGTGG 2 cut(s) 727, 762
CviAII CATG 6 cut(s) 200, 275, 328, 440, 524, 929
CviQI GTAC 5 cut(s) 1133, 1216, 1228, 1426, 1454
DdeI CTNAG 6 cut(s) 146, 301, 423, 831, 1026, 1399
DinI GGCGCC 1 cut(s) 736
DpnI GATC 5 cut(s) 15, 343, 789, 1281, 1476
DpnII GATC 5 cut(s) 13, 341, 787, 1279, 1474
DraIII CACNNNGTG 1 cut(s) 401
Eco130I CCWWGG 1 cut(s) 1331
Eco47I GGWCC 1 cut(s) 1419
Eco57I CTGAAG 1 cut(s) 1284
EcoRII CCWGG 1 cut(s) 1477
EcoT14I CCWWGG 1 cut(s) 1331
EgeI GGCGCC 1 cut(s) 736
EheI GGCGCC 1 cut(s) 736
ErhI CCWWGG 1 cut(s) 1331
FaeI CATG 6 cut(s) 203, 278, 331, 443, 527, 932
FalI AAGNNNNNCTT 2 cut(s) 1424, 1456
FaqI GGGAC 4 cut(s) 447, 671, 1384, 1432
FatI CATG 6 cut(s) 199, 274, 327, 439, 523, 928
FauNDI CATATG 1 cut(s) 1305
Fnu4HI GCNGC 2 cut(s) 6, 265
FokI GGATG 2 cut(s) 197, 1049
Fsp4HI GCNGC 2 cut(s) 6, 265
FspBI CTAG 3 cut(s) 398, 642, 1407
GlaI GCGC 1 cut(s) 736
GluI GCNGC 2 cut(s) 6, 265
GsaI CCCAGC 2 cut(s) 452, 456
GsuI CTGGAG 1 cut(s) 408
HaeII RGCGCY 1 cut(s) 738
HaeIII GGCC 1 cut(s) 288
HapII CCGG 1 cut(s) 1175
HhaI GCGC 1 cut(s) 737
Hin1I GRCGYC 1 cut(s) 735
Hin1II CATG 6 cut(s) 203, 278, 331, 443, 527, 932
Hin6I GCGC 1 cut(s) 735
HinP1I GCGC 1 cut(s) 735
HincII GTYRAC 1 cut(s) 355
HindII GTYRAC 1 cut(s) 355
HindIII AAGCTT 2 cut(s) 881, 888
HinfI GANTC 6 cut(s) 150, 258, 383, 474, 593, 959
HpaII CCGG 1 cut(s) 1175
HphI GGTGA 5 cut(s) 79, 413, 911, 1246, 1320
Hpy166II GTNNAC 2 cut(s) 355, 1216
Hpy188I TCNGA 9 cut(s) 13, 257, 304, 479, 834, 1033, 1057, 1284, 1402
Hpy188III TCNNGA 6 cut(s) 275, 387, 548, 1042, 1175, 1277
Hpy8I GTNNAC 2 cut(s) 355, 1216
HpyAV CCTTC 7 cut(s) 40, 117, 257, 570, 1088, 1244, 1284
HpyCH4III ACNGT 5 cut(s) 352, 469, 703, 838, 1101
HpyCH4V TGCA 3 cut(s) 311, 1001, 1303
HpyF10VI GCNNNNNNNGC 3 cut(s) 1126, 1300, 1392
HpyF3I CTNAG 6 cut(s) 146, 301, 423, 831, 1026, 1399
Hsp92I GRCGYC 1 cut(s) 735
Hsp92II CATG 6 cut(s) 203, 278, 331, 443, 527, 932
HspAI GCGC 1 cut(s) 735
KasI GGCGCC 1 cut(s) 734
Kpn2I TCCGGA 1 cut(s) 1174
Kzo9I GATC 5 cut(s) 13, 341, 787, 1279, 1474
LmnI GCTCC 6 cut(s) 236, 389, 638, 727, 1117, 1177
Lsp1109I GCAGC 2 cut(s) 17, 276
LweI GCATC 2 cut(s) 541, 801
MaeI CTAG 3 cut(s) 398, 642, 1407
MaeIII GTNAC 4 cut(s) 85, 187, 697, 1326
MalI GATC 5 cut(s) 15, 343, 789, 1281, 1476
MboI GATC 5 cut(s) 13, 341, 787, 1279, 1474
MboII GAAGA 7 cut(s) 329, 374, 617, 1057, 1060, 1277, 1474
MfeI CAATTG 2 cut(s) 914, 987
MflI RGATCY 1 cut(s) 13
MluCI AATT 8 cut(s) 674, 848, 914, 987, 1170, 1221, 1237, 1348
Mly113I GGCGCC 1 cut(s) 735
MlyI GAGTC 3 cut(s) 392, 483, 602
MmeI TCCRAC 3 cut(s) 218, 457, 932
MroI TCCGGA 1 cut(s) 1174
MroXI GAANNNNTTC 1 cut(s) 963
MseI TTAA 1 cut(s) 570
MslI CAYNNNNRTG 4 cut(s) 279, 489, 800, 1333
MspA1I CMGCKG 2 cut(s) 267, 452
MspI CCGG 1 cut(s) 1175
MspR9I CCNGG 1 cut(s) 1479
MunI CAATTG 2 cut(s) 914, 987
Mva1269I GAATGC 1 cut(s) 311
MvaI CCWGG 1 cut(s) 1479
MwoI GCNNNNNNNGC 3 cut(s) 1126, 1300, 1392
NarI GGCGCC 1 cut(s) 735
NdeI CATATG 1 cut(s) 1305
NdeII GATC 5 cut(s) 13, 341, 787, 1279, 1474
NlaIII CATG 6 cut(s) 203, 278, 331, 443, 527, 932
NlaIV GGNNCC 2 cut(s) 736, 1420
NmuCI GTSAC 4 cut(s) 85, 187, 697, 1326
NspI RCATGY 1 cut(s) 331
OliI CACNNNNGTG 2 cut(s) 489, 1333
PagI TCATGA 1 cut(s) 274
PciI ACATGT 1 cut(s) 327
PctI GAATGC 1 cut(s) 311
PdmI GAANNNNTTC 1 cut(s) 963
PfeI GAWTC 3 cut(s) 150, 258, 959
PflFI GACNNNGTC 1 cut(s) 938
PfoI TCCNGGA 1 cut(s) 1477
PkrI GCNGC 2 cut(s) 7, 266
PleI GAGTC 3 cut(s) 391, 482, 601
PluTI GGCGCC 1 cut(s) 738
PpsI GAGTC 3 cut(s) 391, 482, 601
PscI ACATGT 1 cut(s) 327
Psp6I CCWGG 1 cut(s) 1477
PspFI CCCAGC 2 cut(s) 448, 452
PspGI CCWGG 1 cut(s) 1477
PspN4I GGNNCC 2 cut(s) 736, 1420
PspPI GGNCC 1 cut(s) 1419
PstI CTGCAG 1 cut(s) 1003
PsuI RGATCY 1 cut(s) 13
PsyI GACNNNGTC 1 cut(s) 938
PvuII CAGCTG 1 cut(s) 452
RsaI GTAC 5 cut(s) 1134, 1217, 1229, 1427, 1455
RsaNI GTAC 5 cut(s) 1133, 1216, 1228, 1426, 1454
RseI CAYNNNNRTG 4 cut(s) 279, 489, 800, 1333
SaqAI TTAA 1 cut(s) 570
SatI GCNGC 2 cut(s) 6, 265
Sau3AI GATC 5 cut(s) 13, 341, 787, 1279, 1474
Sau96I GGNCC 1 cut(s) 1419
ScaI AGTACT 3 cut(s) 1134, 1229, 1427
SchI GAGTC 3 cut(s) 392, 483, 602
ScrFI CCNGG 1 cut(s) 1479
SfaNI GCATC 2 cut(s) 541, 801
SfcI CTRYAG 1 cut(s) 999
SfoI GGCGCC 1 cut(s) 736
SinI GGWCC 1 cut(s) 1419
SmiMI CAYNNNNRTG 4 cut(s) 279, 489, 800, 1333
SmlI CTYRAG 1 cut(s) 487
SmoI CTYRAG 1 cut(s) 487
Sse9I AATT 8 cut(s) 674, 848, 914, 987, 1170, 1221, 1237, 1348
SsiI CCGC 2 cut(s) 262, 267
SspDI GGCGCC 1 cut(s) 734
SspMI CTAG 3 cut(s) 398, 642, 1407
StyD4I CCNGG 1 cut(s) 1477
StyI CCWWGG 1 cut(s) 1331
TaaI ACNGT 5 cut(s) 352, 469, 703, 838, 1101
TaqI TCGA 3 cut(s) 340, 381, 942
TasI AATT 8 cut(s) 674, 848, 914, 987, 1170, 1221, 1237, 1348
TatI WGTACW 4 cut(s) 1132, 1215, 1227, 1425
TfiI GAWTC 3 cut(s) 150, 258, 959
Tru1I TTAA 1 cut(s) 570
Tru9I TTAA 1 cut(s) 570
TscAI CASTG 2 cut(s) 474, 843
TseFI GTSAC 4 cut(s) 85, 187, 697, 1326
TseI GCWGC 2 cut(s) 5, 264
Tsp45I GTSAC 4 cut(s) 85, 187, 697, 1326
TspDTI ATGAA 8 cut(s) 99, 172, 304, 381, 740, 784, 1329, 1512
TspRI CASTG 2 cut(s) 474, 843
Tth111I GACNNNGTC 1 cut(s) 938
VpaK11BI GGWCC 1 cut(s) 1419
XapI RAATTY 3 cut(s) 848, 1170, 1221
XceI RCATGY 1 cut(s) 331
XmnI GAANNNNTTC 1 cut(s) 963
XspI CTAG 3 cut(s) 398, 642, 1407
ZrmI AGTACT 3 cut(s) 1134, 1229, 1427
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.