Rmu_sc0016737.1_g000011

S-norcoclaurine synthase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016737.1
Physical Location & Seq
Reverse (-)
32947 .. 34712
1766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016737.1_g000011.1.cds

Sequence Viewer

Length: 288 bp
atggttagcgggcaagtttcgcatgaattacaagttgaagtgtctgcaagccaagcatggcatctgtatggcactcttgcgctcgctaggttcgtggaacatactctcaccaatgtaattgacaaaattgaagtcgaacaaggcgatggagaactaggcaccattctcgaagtaacatttgcaccaggattaccagggcctgggtggcataaggagaagttcacaatggtagataatgaaaaacaggtgaaggaagttcatgtgattgaggatggatatctggagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.56

Weight (kDa)

4.74

Isoelectric Point (pI)

32.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 158
AccB7I CCANNNNNTGG 1 cut(s) 200
AciI CCGC 1 cut(s) 9
AfiI CCNNNNNNNGG 1 cut(s) 200
AgsI TTSAA 2 cut(s) 38, 131
AjnI CCWGG 3 cut(s) 184, 193, 199
AlwNI CAGNNNCTG 1 cut(s) 200
AoxI GGCC 1 cut(s) 197
ArsI GACNNNNNNTTYG 2 cut(s) 117, 149
AspLEI GCGC 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 197
AsuHPI GGTGA 2 cut(s) 100, 259
BanI GGYRCC 1 cut(s) 158
BccI CCATC 2 cut(s) 140, 266
BcgI CGANNNNNNTGC 2 cut(s) 148, 182
BciT130I CCWGG 3 cut(s) 186, 195, 201
BfaI CTAG 2 cut(s) 87, 155
BglI GCCNNNNNGGC 1 cut(s) 205
Bme1390I CCNGG 3 cut(s) 186, 195, 201
BmgT120I GGNCC 1 cut(s) 197
BmiI GGNNCC 1 cut(s) 160
BmrFI CCNGG 3 cut(s) 186, 195, 201
BmsI GCATC 1 cut(s) 70
BsaBI GATNNNNATC 1 cut(s) 276
BsaJI CCNNGG 2 cut(s) 194, 200
Bsc4I CCNNNNNNNGG 1 cut(s) 200
Bse8I GATNNNNATC 1 cut(s) 276
BseBI CCWGG 3 cut(s) 186, 195, 201
BseDI CCNNGG 2 cut(s) 194, 200
BseGI GGATG 1 cut(s) 277
BseJI GATNNNNATC 1 cut(s) 276
BseLI CCNNNNNNNGG 1 cut(s) 200
BshFI GGCC 1 cut(s) 199
BshNI GGYRCC 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 200
BsnI GGCC 1 cut(s) 199
BspACI CCGC 1 cut(s) 9
BspANI GGCC 1 cut(s) 199
BspLI GGNNCC 1 cut(s) 160
BspT107I GGYRCC 1 cut(s) 158
BssECI CCNNGG 2 cut(s) 194, 200
Bst2UI CCWGG 3 cut(s) 186, 195, 201
BstC8I GCNNGC 3 cut(s) 11, 49, 84
BstF5I GGATG 1 cut(s) 277
BstHHI GCGC 1 cut(s) 82
BstMWI GCNNNNNNNGC 3 cut(s) 19, 53, 205
BstNI CCWGG 3 cut(s) 186, 195, 201
BstSCI CCNGG 3 cut(s) 184, 193, 199
BsuRI GGCC 1 cut(s) 199
BtgZI GCGATG 1 cut(s) 159
BtsCI GGATG 1 cut(s) 277
Cac8I GCNNGC 3 cut(s) 11, 49, 84
CaiI CAGNNNCTG 1 cut(s) 200
CfoI GCGC 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 197
CviAII CATG 3 cut(s) 23, 57, 260
CviJI RGCY 2 cut(s) 51, 199
CviKI_1 RGCY 2 cut(s) 51, 199
Eco32I GATATC 1 cut(s) 278
EcoO109I RGGNCCY 1 cut(s) 197
EcoRII CCWGG 3 cut(s) 184, 193, 199
EcoRV GATATC 1 cut(s) 278
FaeI CATG 3 cut(s) 26, 60, 263
FaiI YATR 6 cut(s) 24, 58, 69, 102, 210, 261
FatI CATG 3 cut(s) 22, 56, 259
FauI CCCGC 1 cut(s) 2
FokI GGATG 1 cut(s) 284
FspBI CTAG 2 cut(s) 87, 155
GlaI GCGC 1 cut(s) 81
HaeIII GGCC 1 cut(s) 199
HhaI GCGC 1 cut(s) 82
Hin1II CATG 3 cut(s) 26, 60, 263
Hin6I GCGC 1 cut(s) 80
HinP1I GCGC 1 cut(s) 80
HphI GGTGA 2 cut(s) 100, 259
Hpy166II GTNNAC 1 cut(s) 222
Hpy188III TCNNGA 2 cut(s) 167, 281
Hpy8I GTNNAC 1 cut(s) 222
HpyAV CCTTC 1 cut(s) 244
HpyCH4V TGCA 2 cut(s) 47, 182
HpyF10VI GCNNNNNNNGC 3 cut(s) 19, 53, 205
Hsp92II CATG 3 cut(s) 26, 60, 263
HspAI GCGC 1 cut(s) 80
LpnPI CCDG 8 cut(s) 171, 180, 186, 198, 207, 213, 230, 266
LweI GCATC 1 cut(s) 70
MaeI CTAG 2 cut(s) 87, 155
MaeIII GTNAC 1 cut(s) 172
MluCI AATT 3 cut(s) 26, 117, 126
MnlI CCTC 1 cut(s) 262
MslI CAYNNNNRTG 1 cut(s) 66
MspR9I CCNGG 3 cut(s) 186, 195, 201
MvaI CCWGG 3 cut(s) 186, 195, 201
MwoI GCNNNNNNNGC 3 cut(s) 19, 53, 205
NlaIII CATG 3 cut(s) 26, 60, 263
NlaIV GGNNCC 1 cut(s) 160
PcsI WCGNNNNNNNCGW 2 cut(s) 90, 141
PflMI CCANNNNNTGG 1 cut(s) 200
Psp6I CCWGG 3 cut(s) 184, 193, 199
PspGI CCWGG 3 cut(s) 184, 193, 199
PspN4I GGNNCC 1 cut(s) 160
PspPI GGNCC 1 cut(s) 197
PstNI CAGNNNCTG 1 cut(s) 200
RseI CAYNNNNRTG 1 cut(s) 66
Sau96I GGNCC 1 cut(s) 197
ScrFI CCNGG 3 cut(s) 186, 195, 201
SetI ASST 2 cut(s) 92, 249
SfaNI GCATC 1 cut(s) 70
SmiMI CAYNNNNRTG 1 cut(s) 66
Sse9I AATT 3 cut(s) 26, 117, 126
SsiI CCGC 1 cut(s) 9
SspMI CTAG 2 cut(s) 87, 155
StyD4I CCNGG 3 cut(s) 184, 193, 199
TaqI TCGA 2 cut(s) 135, 168
TasI AATT 3 cut(s) 26, 117, 126
TspDTI ATGAA 3 cut(s) 39, 248, 252
Van91I CCANNNNNTGG 1 cut(s) 200
XcmI CCANNNNNNNNNTGG 1 cut(s) 201
XspI CTAG 2 cut(s) 87, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.