Rmu_sc0018900.1_g000003

Belongs to the pyrroline-5-carboxylate reductase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018900.1
Physical Location & Seq
Reverse (-)
29529 .. 30559
1031 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018900.1_g000003.1.cds

Sequence Viewer

Length: 349 bp
aggcaagatatggaaagccgatgaaaagttctttgatgcaattactggcctaagtggcagtggtcctgcatatatatatttggctatagaggctttggcagatggaggagttgctgcaggtctaccacgtgaacttgcattgggtctagcatctcaaactgtattaggagcagcatctatggctactagctctgggaagcatccaggtcagctaaaagatgatgtaacatcaccaggtggaactaccattgctggcattcatgaactggagaagggtggatttcgtggaatattgatgaatgcagttgttgctgctgccaggcgcagccgagagctttcacagaactag

Protein Analysis

115

Amino Acids

11.7

Weight (kDa)

6.94

Isoelectric Point (pI)

33.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018872)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 108
AccI GTMKAC 1 cut(s) 122
AcvI CACGTG 1 cut(s) 129
AdeI CACNNNGTG 1 cut(s) 237
AjnI CCWGG 3 cut(s) 203, 233, 318
AluBI AGCT 3 cut(s) 190, 212, 335
AluI AGCT 3 cut(s) 190, 212, 335
AoxI GGCC 1 cut(s) 47
ApeKI GCWGC 5 cut(s) 114, 171, 312, 315, 325
AspLEI GCGC 1 cut(s) 325
AspS9I GGNCC 1 cut(s) 63
AsuHPI GGTGA 1 cut(s) 223
AvaII GGWCC 1 cut(s) 63
BbrPI CACGTG 1 cut(s) 129
BbvI GCAGC 5 cut(s) 101, 183, 299, 302, 337
BccI CCATC 1 cut(s) 96
BciT130I CCWGG 3 cut(s) 205, 235, 320
BfaI CTAG 3 cut(s) 147, 187, 347
BfmI CTRYAG 2 cut(s) 85, 115
BfuAI ACCTGC 1 cut(s) 108
BglI GCCNNNNNGGC 1 cut(s) 55
BisI GCNGC 5 cut(s) 115, 172, 313, 316, 326
BlsI GCNGC 5 cut(s) 116, 173, 314, 317, 327
Bme1390I CCNGG 3 cut(s) 205, 235, 320
Bme18I GGWCC 1 cut(s) 63
BmgT120I GGNCC 1 cut(s) 63
BmrFI CCNGG 3 cut(s) 205, 235, 320
BmsI GCATC 4 cut(s) 26, 159, 183, 209
BpmI CTGGAG 1 cut(s) 288
BsaAI YACGTR 1 cut(s) 129
Bse1I ACTGG 2 cut(s) 50, 271
Bse3DI GCAATG 1 cut(s) 247
BseBI CCWGG 3 cut(s) 205, 235, 320
BseGI GGATG 1 cut(s) 200
BseMI GCAATG 1 cut(s) 247
BseNI ACTGG 2 cut(s) 50, 271
BseRI GAGGAG 1 cut(s) 121
BseXI GCAGC 5 cut(s) 101, 183, 299, 302, 337
BshFI GGCC 1 cut(s) 49
BsmI GAATGC 2 cut(s) 256, 305
BsnI GGCC 1 cut(s) 49
BspANI GGCC 1 cut(s) 49
BspHI TCATGA 1 cut(s) 260
BspMAI CTGCAG 1 cut(s) 119
BspMI ACCTGC 1 cut(s) 108
BsrDI GCAATG 1 cut(s) 247
BsrI ACTGG 2 cut(s) 50, 271
Bst2UI CCWGG 3 cut(s) 205, 235, 320
Bst4CI ACNGT 1 cut(s) 161
BstAPI GCANNNNNTGC 1 cut(s) 309
BstBAI YACGTR 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 254
BstDEI CTNAG 1 cut(s) 51
BstF5I GGATG 1 cut(s) 200
BstHHI GCGC 1 cut(s) 325
BstMWI GCNNNNNNNGC 4 cut(s) 55, 90, 180, 309
BstNI CCWGG 3 cut(s) 205, 235, 320
BstSCI CCNGG 3 cut(s) 203, 233, 318
BstSFI CTRYAG 2 cut(s) 85, 115
BstV1I GCAGC 5 cut(s) 101, 183, 299, 302, 337
BsuRI GGCC 1 cut(s) 49
BtsCI GGATG 1 cut(s) 200
BtsI GCAGTG 1 cut(s) 65
BtsIMutI CAGTG 1 cut(s) 65
BveI ACCTGC 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 254
CciI TCATGA 1 cut(s) 260
CfoI GCGC 1 cut(s) 325
Cfr13I GGNCC 1 cut(s) 63
CsiI ACCWGGT 1 cut(s) 233
CviAII CATG 1 cut(s) 261
CviJI RGCY 9 cut(s) 18, 49, 84, 93, 183, 190, 212, 328, 335
CviKI_1 RGCY 9 cut(s) 18, 49, 84, 93, 183, 190, 212, 328, 335
DdeI CTNAG 1 cut(s) 51
DraIII CACNNNGTG 1 cut(s) 237
Eco47I GGWCC 1 cut(s) 63
Eco72I CACGTG 1 cut(s) 129
EcoRII CCWGG 3 cut(s) 203, 233, 318
FaeI CATG 1 cut(s) 264
FaiI YATR 8 cut(s) 11, 71, 73, 75, 77, 87, 180, 262
FatI CATG 1 cut(s) 260
FblI GTMKAC 1 cut(s) 122
Fnu4HI GCNGC 5 cut(s) 115, 172, 313, 316, 326
FokI GGATG 1 cut(s) 187
Fsp4HI GCNGC 5 cut(s) 115, 172, 313, 316, 326
FspBI CTAG 3 cut(s) 147, 187, 347
GlaI GCGC 1 cut(s) 324
GluI GCNGC 5 cut(s) 115, 172, 313, 316, 326
GsuI CTGGAG 1 cut(s) 288
HaeIII GGCC 1 cut(s) 49
HhaI GCGC 1 cut(s) 325
Hin1II CATG 1 cut(s) 264
Hin6I GCGC 1 cut(s) 323
HinP1I GCGC 1 cut(s) 323
HphI GGTGA 1 cut(s) 223
Hpy166II GTNNAC 2 cut(s) 123, 132
Hpy188III TCNNGA 1 cut(s) 261
Hpy8I GTNNAC 2 cut(s) 123, 132
HpyAV CCTTC 1 cut(s) 266
HpyCH4III ACNGT 1 cut(s) 161
HpyCH4IV ACGT 1 cut(s) 128
HpyCH4V TGCA 5 cut(s) 39, 69, 117, 138, 303
HpyF10VI GCNNNNNNNGC 4 cut(s) 55, 90, 180, 309
HpyF3I CTNAG 1 cut(s) 51
HpySE526I ACGT 1 cut(s) 128
Hsp92II CATG 1 cut(s) 264
HspAI GCGC 1 cut(s) 323
LmnI GCTCC 1 cut(s) 168
Lsp1109I GCAGC 5 cut(s) 101, 183, 299, 302, 337
LweI GCATC 4 cut(s) 26, 159, 183, 209
MabI ACCWGGT 1 cut(s) 233
MaeI CTAG 3 cut(s) 147, 187, 347
MaeII ACGT 1 cut(s) 128
MaeIII GTNAC 1 cut(s) 224
MluCI AATT 1 cut(s) 40
MnlI CCTC 2 cut(s) 83, 99
MspR9I CCNGG 3 cut(s) 205, 235, 320
Mva1269I GAATGC 2 cut(s) 256, 305
MvaI CCWGG 3 cut(s) 205, 235, 320
MwoI GCNNNNNNNGC 4 cut(s) 55, 90, 180, 309
NlaIII CATG 1 cut(s) 264
PagI TCATGA 1 cut(s) 260
PctI GAATGC 2 cut(s) 256, 305
PkrI GCNGC 5 cut(s) 116, 173, 314, 317, 327
PmaCI CACGTG 1 cut(s) 129
PmlI CACGTG 1 cut(s) 129
Ppu21I YACGTR 1 cut(s) 129
Psp6I CCWGG 3 cut(s) 203, 233, 318
PspCI CACGTG 1 cut(s) 129
PspGI CCWGG 3 cut(s) 203, 233, 318
PspPI GGNCC 1 cut(s) 63
PstI CTGCAG 1 cut(s) 119
SatI GCNGC 5 cut(s) 115, 172, 313, 316, 326
Sau96I GGNCC 1 cut(s) 63
ScrFI CCNGG 3 cut(s) 205, 235, 320
SetI ASST 7 cut(s) 122, 131, 192, 209, 214, 239, 337
SexAI ACCWGGT 1 cut(s) 233
SfaNI GCATC 4 cut(s) 26, 159, 183, 209
SfcI CTRYAG 2 cut(s) 85, 115
SinI GGWCC 1 cut(s) 63
Sse9I AATT 1 cut(s) 40
SspI AATATT 1 cut(s) 292
SspMI CTAG 3 cut(s) 147, 187, 347
StyD4I CCNGG 3 cut(s) 203, 233, 318
TaaI ACNGT 1 cut(s) 161
TaiI ACGT 1 cut(s) 131
TasI AATT 1 cut(s) 40
TscAI CASTG 1 cut(s) 65
TseI GCWGC 5 cut(s) 114, 171, 312, 315, 325
TspDTI ATGAA 4 cut(s) 37, 249, 277, 312
TspRI CASTG 1 cut(s) 65
VpaK11BI GGWCC 1 cut(s) 63
XmiI GTMKAC 1 cut(s) 122
XspI CTAG 3 cut(s) 147, 187, 347
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.