Rroxscaffold_2G00118750

Belongs to the pyrroline-5-carboxylate reductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0018872
Physical Location & Seq
Forward (+)
50557991 .. 50646424
88434 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00118750.1

Sequence Viewer

Length: 456 bp
ATGCCTAATACTCCTTCTGCTGTTGGTGTTGCAGCATCAGTTTTGAGCTTGGGAGGAGCTGCAACAGAACAAGATGGAGACTTAATAGCTGAATTATTTGGATCAGTAGGCAAGATTTGGAAAGCCGATGAAAAATTGTTTGATGCAATTACTGGCCTAAGCGGCAGTGGTCCTGCATATATATATTTGGCTATAGAGGCTTTGGCAGATGGAGGAGTTGCTGGAGGTCTACCACGAGAACTTGCATTGGGTCTAGCATCTCAAACTGTATTAGGAGCAGCATCTATGGCTACTAGTTCTGGGAAGCATCCAGGTCAGCTAAAAGATGATGTAACATCACCTGGTGGAACTACCATTACTGGCATTCATGAGCTGGAGAAGGGTGGATTTCGTGGAATATTGATGAATGCAGTTGTTGCTGCTGCCAGGCACAGCCGAGAACTTTCACAGAACTAG

Protein Analysis

151

Amino Acids

15.09

Weight (kDa)

5.04

Isoelectric Point (pI)

28.57

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
P5CR_dimer PF14748 44 - 148 1.2e-41 Pyrroline-5-carboxylate reductase dimerisation
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018872)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g06311
rosa_chinensis RchiOBHm_Chr2g0125021
rosa_multiflora Rmu_sc0001251.1_g000011 Rmu_sc0018900.1_g000003
rosa_roxburghii Rroxscaffold_2G00118400 Rroxscaffold_2G00118410 Rroxscaffold_2G00118430 Rroxscaffold_2G00118750
rosa_samantha Rh2DG340200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 229
AciI CCGC 1 cut(s) 162
AclWI GGATC 1 cut(s) 109
AdeI CACNNNGTG 1 cut(s) 344
AhlI ACTAGT 1 cut(s) 293
AjnI CCWGG 3 cut(s) 310, 340, 425
AluBI AGCT 5 cut(s) 48, 59, 89, 319, 373
AluI AGCT 5 cut(s) 48, 59, 89, 319, 373
Alw26I GTCTC 1 cut(s) 72
AlwI GGATC 1 cut(s) 109
AoxI GGCC 1 cut(s) 154
ApeKI GCWGC 5 cut(s) 32, 59, 278, 419, 422
AspS9I GGNCC 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 330
AvaII GGWCC 1 cut(s) 170
BauI CACGAG 1 cut(s) 234
BbvI GCAGC 5 cut(s) 44, 46, 290, 406, 409
BccI CCATC 2 cut(s) 68, 203
BciT130I CCWGG 3 cut(s) 312, 342, 427
BcoDI GTCTC 1 cut(s) 72
BcuI ACTAGT 1 cut(s) 293
BfaI CTAG 3 cut(s) 254, 294, 454
BfmI CTRYAG 1 cut(s) 192
BglI GCCNNNNNGGC 1 cut(s) 162
BisI GCNGC 6 cut(s) 33, 60, 163, 279, 420, 423
BlsI GCNGC 6 cut(s) 34, 61, 164, 280, 421, 424
Bme1390I CCNGG 3 cut(s) 312, 342, 427
Bme18I GGWCC 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 170
BmrFI CCNGG 3 cut(s) 312, 342, 427
BmsI GCATC 5 cut(s) 44, 133, 266, 290, 316
BpmI CTGGAG 2 cut(s) 243, 395
Bpu10I CCTNAGC 1 cut(s) 158
Bse1I ACTGG 2 cut(s) 157, 364
BseBI CCWGG 3 cut(s) 312, 342, 427
BseGI GGATG 1 cut(s) 307
BseNI ACTGG 2 cut(s) 157, 364
BseRI GAGGAG 2 cut(s) 69, 228
BseXI GCAGC 5 cut(s) 44, 46, 290, 406, 409
BshFI GGCC 1 cut(s) 156
BsmAI GTCTC 1 cut(s) 72
BsmI GAATGC 2 cut(s) 363, 412
BsnI GGCC 1 cut(s) 156
Bsp143I GATC 1 cut(s) 101
BspACI CCGC 1 cut(s) 162
BspANI GGCC 1 cut(s) 156
BspHI TCATGA 1 cut(s) 367
BspPI GGATC 1 cut(s) 109
BsrI ACTGG 2 cut(s) 157, 364
BssMI GATC 1 cut(s) 101
BssSI CACGAG 1 cut(s) 234
Bst2BI CACGAG 1 cut(s) 234
Bst2UI CCWGG 3 cut(s) 312, 342, 427
Bst4CI ACNGT 1 cut(s) 268
BstAPI GCANNNNNTGC 1 cut(s) 416
BstDEI CTNAG 1 cut(s) 158
BstF5I GGATG 1 cut(s) 307
BstKTI GATC 1 cut(s) 104
BstMAI GTCTC 1 cut(s) 72
BstMBI GATC 1 cut(s) 101
BstMWI GCNNNNNNNGC 4 cut(s) 162, 197, 287, 416
BstNI CCWGG 3 cut(s) 312, 342, 427
BstSCI CCNGG 3 cut(s) 310, 340, 425
BstSFI CTRYAG 1 cut(s) 192
BstV1I GCAGC 5 cut(s) 44, 46, 290, 406, 409
BsuRI GGCC 1 cut(s) 156
BtsCI GGATG 1 cut(s) 307
BtsI GCAGTG 1 cut(s) 172
BtsIMutI CAGTG 1 cut(s) 172
CciI TCATGA 1 cut(s) 367
Cfr13I GGNCC 1 cut(s) 170
CsiI ACCWGGT 1 cut(s) 340
CviAII CATG 1 cut(s) 368
DdeI CTNAG 1 cut(s) 158
DpnI GATC 1 cut(s) 103
DpnII GATC 1 cut(s) 101
DraIII CACNNNGTG 1 cut(s) 344
Eco47I GGWCC 1 cut(s) 170
EcoRII CCWGG 3 cut(s) 310, 340, 425
FaeI CATG 1 cut(s) 371
FaiI YATR 7 cut(s) 178, 180, 182, 184, 194, 287, 369
FatI CATG 1 cut(s) 367
FblI GTMKAC 1 cut(s) 229
Fnu4HI GCNGC 6 cut(s) 33, 60, 163, 279, 420, 423
FokI GGATG 1 cut(s) 294
Fsp4HI GCNGC 6 cut(s) 33, 60, 163, 279, 420, 423
FspBI CTAG 3 cut(s) 254, 294, 454
GluI GCNGC 6 cut(s) 33, 60, 163, 279, 420, 423
GsuI CTGGAG 2 cut(s) 243, 395
HaeIII GGCC 1 cut(s) 156
Hin1II CATG 1 cut(s) 371
HphI GGTGA 1 cut(s) 330
Hpy166II GTNNAC 1 cut(s) 230
Hpy188III TCNNGA 1 cut(s) 368
Hpy8I GTNNAC 1 cut(s) 230
HpyAV CCTTC 2 cut(s) 24, 373
HpyCH4III ACNGT 1 cut(s) 268
HpyCH4V TGCA 6 cut(s) 32, 62, 146, 176, 245, 410
HpyF10VI GCNNNNNNNGC 4 cut(s) 162, 197, 287, 416
HpyF3I CTNAG 1 cut(s) 158
Hsp92II CATG 1 cut(s) 371
Kzo9I GATC 1 cut(s) 101
LmnI GCTCC 2 cut(s) 56, 275
Lsp1109I GCAGC 5 cut(s) 44, 46, 290, 406, 409
LweI GCATC 5 cut(s) 44, 133, 266, 290, 316
MabI ACCWGGT 1 cut(s) 340
MaeI CTAG 3 cut(s) 254, 294, 454
MaeIII GTNAC 1 cut(s) 331
MalI GATC 1 cut(s) 103
MboI GATC 1 cut(s) 101
MluCI AATT 3 cut(s) 92, 134, 147
MnlI CCTC 4 cut(s) 47, 190, 206, 218
MseI TTAA 1 cut(s) 83
MspR9I CCNGG 3 cut(s) 312, 342, 427
Mva1269I GAATGC 2 cut(s) 363, 412
MvaI CCWGG 3 cut(s) 312, 342, 427
MwoI GCNNNNNNNGC 4 cut(s) 162, 197, 287, 416
NdeII GATC 1 cut(s) 101
NlaIII CATG 1 cut(s) 371
PagI TCATGA 1 cut(s) 367
PctI GAATGC 2 cut(s) 363, 412
PkrI GCNGC 6 cut(s) 34, 61, 164, 280, 421, 424
Psp6I CCWGG 3 cut(s) 310, 340, 425
PspGI CCWGG 3 cut(s) 310, 340, 425
PspPI GGNCC 1 cut(s) 170
PsrI GAACNNNNNNTAC 2 cut(s) 340, 372
SaqAI TTAA 1 cut(s) 83
SatI GCNGC 6 cut(s) 33, 60, 163, 279, 420, 423
Sau3AI GATC 1 cut(s) 101
Sau96I GGNCC 1 cut(s) 170
ScrFI CCNGG 3 cut(s) 312, 342, 427
SetI ASST 8 cut(s) 50, 61, 91, 229, 316, 321, 343, 375
SexAI ACCWGGT 1 cut(s) 340
SfaNI GCATC 5 cut(s) 44, 133, 266, 290, 316
SfcI CTRYAG 1 cut(s) 192
SinI GGWCC 1 cut(s) 170
SpeI ACTAGT 1 cut(s) 293
Sse9I AATT 3 cut(s) 92, 134, 147
SsiI CCGC 1 cut(s) 162
SspI AATATT 1 cut(s) 399
SspMI CTAG 3 cut(s) 254, 294, 454
StyD4I CCNGG 3 cut(s) 310, 340, 425
TaaI ACNGT 1 cut(s) 268
TasI AATT 3 cut(s) 92, 134, 147
TauI GCSGC 1 cut(s) 165
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TscAI CASTG 1 cut(s) 172
TseI GCWGC 5 cut(s) 32, 59, 278, 419, 422
TspDTI ATGAA 3 cut(s) 144, 356, 419
TspRI CASTG 1 cut(s) 172
VpaK11BI GGWCC 1 cut(s) 170
XmiI GTMKAC 1 cut(s) 229
XspI CTAG 3 cut(s) 254, 294, 454
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.