Rmu_sc0021983.1_g000001

39S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021983.1
Physical Location & Seq
Forward (+)
1253 .. 1833
581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021983.1_g000001.1.cds

Sequence Viewer

Length: 279 bp
atgccactggggctaataatggggctaggaagggcatttcgtcgaaagcgaacggcatcccttgacattctttcccccaaacgagccccaaggaacttttacaaggggaagaactgcaaacccactggtttccacacccgaaaaggtggatatgttgtggtgcaggacaaactacccaactatgtagtccctgatttagctgacttcaagctcaaaccatatgtatctcagtgccccaaagaggtcaagactgcagagacagccgaatcaactaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.33

Weight (kDa)

10.12

Isoelectric Point (pI)

36.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 241
AgsI TTSAA 1 cut(s) 208
AluBI AGCT 2 cut(s) 200, 211
AluI AGCT 2 cut(s) 200, 211
Alw26I GTCTC 1 cut(s) 251
BaeGI GKGCMC 1 cut(s) 236
BanII GRGCYC 1 cut(s) 88
BceAI ACGGC 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 251
BfaI CTAG 1 cut(s) 26
BfmI CTRYAG 1 cut(s) 252
BglI GCCNNNNNGGC 1 cut(s) 10
BmrI ACTGGG 1 cut(s) 17
BmsI GCATC 1 cut(s) 65
BmuI ACTGGG 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 241
Bse1I ACTGG 2 cut(s) 12, 130
BseDI CCNNGG 1 cut(s) 89
BseGI GGATG 1 cut(s) 56
BseLI CCNNNNNNNGG 1 cut(s) 241
BseMII CTCAG 1 cut(s) 242
BseNI ACTGG 2 cut(s) 12, 130
BseSI GKGCMC 1 cut(s) 236
BsgI GTGCAG 1 cut(s) 182
BslFI GGGAC 1 cut(s) 173
BslI CCNNNNNNNGG 1 cut(s) 241
BsmAI GTCTC 1 cut(s) 251
BsmFI GGGAC 1 cut(s) 173
Bsp1286I GDGCHC 2 cut(s) 88, 236
BspCNI CTCAG 1 cut(s) 241
BspMAI CTGCAG 1 cut(s) 256
BsrI ACTGG 2 cut(s) 12, 130
BssECI CCNNGG 1 cut(s) 89
BssT1I CCWWGG 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 228
BstF5I GGATG 1 cut(s) 56
BstMAI GTCTC 1 cut(s) 251
BstMWI GCNNNNNNNGC 2 cut(s) 10, 260
BstSFI CTRYAG 1 cut(s) 252
BstSLI GKGCMC 1 cut(s) 236
BtsCI GGATG 1 cut(s) 56
BtsIMutI CAGTG 3 cut(s) 5, 123, 236
CviJI RGCY 6 cut(s) 13, 25, 86, 200, 211, 263
CviKI_1 RGCY 6 cut(s) 13, 25, 86, 200, 211, 263
DdeI CTNAG 1 cut(s) 228
Eco130I CCWWGG 1 cut(s) 89
Eco24I GRGCYC 1 cut(s) 88
EcoT14I CCWWGG 1 cut(s) 89
EcoT38I GRGCYC 1 cut(s) 88
ErhI CCWWGG 1 cut(s) 89
FaiI YATR 4 cut(s) 153, 183, 220, 222
FaqI GGGAC 1 cut(s) 173
FauNDI CATATG 1 cut(s) 220
FokI GGATG 1 cut(s) 43
FriOI GRGCYC 1 cut(s) 88
FspBI CTAG 1 cut(s) 26
HinfI GANTC 1 cut(s) 266
Hpy188III TCNNGA 1 cut(s) 247
Hpy99I CGWCG 1 cut(s) 45
HpyAV CCTTC 1 cut(s) 24
HpyCH4V TGCA 3 cut(s) 117, 163, 254
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 260
HpyF3I CTNAG 1 cut(s) 228
LpnPI CCDG 3 cut(s) 111, 149, 204
LweI GCATC 1 cut(s) 65
MaeI CTAG 1 cut(s) 26
MboII GAAGA 1 cut(s) 121
MhlI GDGCHC 2 cut(s) 88, 236
MnlI CCTC 1 cut(s) 235
MwoI GCNNNNNNNGC 2 cut(s) 10, 260
NdeI CATATG 1 cut(s) 220
PcsI WCGNNNNNNNCGW 1 cut(s) 46
PfeI GAWTC 1 cut(s) 266
PstI CTGCAG 1 cut(s) 256
SduI GDGCHC 2 cut(s) 88, 236
SetI ASST 4 cut(s) 148, 202, 213, 246
SfaNI GCATC 1 cut(s) 65
SfcI CTRYAG 1 cut(s) 252
SspMI CTAG 1 cut(s) 26
StyI CCWWGG 1 cut(s) 89
TaqI TCGA 1 cut(s) 43
TfiI GAWTC 1 cut(s) 266
TscAI CASTG 3 cut(s) 12, 130, 236
TspRI CASTG 3 cut(s) 12, 130, 236
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.