Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0025906.1

Orthogroup ID

OG0008279

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 766

Gene Structure 765 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0025906.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 280 bp

ctagtggttacttgatagtggaggttaatggcggtcttaaccaacaacgctctgcgatttgcaacgccgtggctcttgctggacttttgaatgcaattctagttattcctcaatttgaattcaatagtgtttggagagatcaaagtacttttagcgatatatatgatgaagatcatttcgtagctacccttgagggctacgttagagtggttaaagaactacctgaggtactgctggagagatatggtcataacatcagtaacataccaaatattcgtgt

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

O-FucT

Protein Analysis

93

Amino Acids

10.43

Weight (kDa)

4.74

Isoelectric Point (pI)

43.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008279)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G38065 AT1G38065 AT1G38131
fragaria_vesca	FvH4_2g26360 FvH4_2g26360 FvH4_2g26360 FvH4_2g26360
malus_domestica	MD08G1169500.v1.1 MD15G1356100.v1.1
prunus_persica	Prupe.1G503400_v2.0.a1 Prupe.1G503400_v2.0.a1
pyrus_communis	pycom08g14500 pycom15g31810
rosa_chinensis	RchiOBHm_Chr6g0294941
rosa_multiflora	Rmu_sc0025906.1_g000001 Rmu_sc0025907.1_g000001
rosa_roxburghii	Rroxscaffold_7G00172810
rosa_rugosa	Rorug06G0248500
rosa_samantha	Rh6AG361700 Rh6BG369200 Rh6CG375700 Rh6DG362200
rosa_wichuraiana	Rw6G031550

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	32
AcsI	RAATTY	1 cut(s)	118
AfaI	GTAC	2 cut(s)	147, 230
AgsI	TTSAA	3 cut(s)	90, 118, 123
AluBI	AGCT	1 cut(s)	184
AluI	AGCT	1 cut(s)	184
ApoI	RAATTY	1 cut(s)	118
AxyI	CCTNAGG	1 cut(s)	224
BceAI	ACGGC	1 cut(s)	52
BfaI	CTAG	2 cut(s)	2, 100
BmcAI	AGTACT	1 cut(s)	147
BpmI	CTGGAG	1 cut(s)	256
BpuEI	CTTGAG	1 cut(s)	211
BsaBI	GATNNNNATC	1 cut(s)	170
BsaJI	CCNNGG	1 cut(s)	68
Bse21I	CCTNAGG	1 cut(s)	224
Bse8I	GATNNNNATC	1 cut(s)	170
BseDI	CCNNGG	1 cut(s)	68
BseJI	GATNNNNATC	1 cut(s)	170
BseMII	CTCAG	1 cut(s)	215
BsmI	GAATGC	1 cut(s)	96
Bsp143I	GATC	2 cut(s)	138, 171
BspACI	CCGC	1 cut(s)	32
BspCNI	CTCAG	1 cut(s)	216
BssECI	CCNNGG	1 cut(s)	68
BssMI	GATC	2 cut(s)	138, 171
BstDEI	CTNAG	1 cut(s)	224
BstDSI	CCRYGG	1 cut(s)	68
BstKTI	GATC	2 cut(s)	141, 174
BstMBI	GATC	2 cut(s)	138, 171
Bsu36I	CCTNAGG	1 cut(s)	224
BtgI	CCRYGG	1 cut(s)	68
Csp6I	GTAC	2 cut(s)	146, 229
CviJI	RGCY	3 cut(s)	73, 184, 197
CviKI_1	RGCY	3 cut(s)	73, 184, 197
CviQI	GTAC	2 cut(s)	146, 229
DdeI	CTNAG	1 cut(s)	224
DpnI	GATC	2 cut(s)	140, 173
DpnII	GATC	2 cut(s)	138, 171
Eco81I	CCTNAGG	1 cut(s)	224
EcoRI	GAATTC	1 cut(s)	118
FaiI	YATR	6 cut(s)	160, 162, 164, 245, 251, 265
FspBI	CTAG	2 cut(s)	2, 100
GsuI	CTGGAG	1 cut(s)	256
HpyCH4IV	ACGT	1 cut(s)	200
HpyCH4V	TGCA	2 cut(s)	62, 94
HpyF3I	CTNAG	1 cut(s)	224
HpySE526I	ACGT	1 cut(s)	200
Kzo9I	GATC	2 cut(s)	138, 171
LpnPI	CCDG	3 cut(s)	65, 220, 236
MaeI	CTAG	2 cut(s)	2, 100
MaeII	ACGT	1 cut(s)	200
MaeIII	GTNAC	2 cut(s)	7, 259
MalI	GATC	2 cut(s)	140, 173
MboI	GATC	2 cut(s)	138, 171
MboII	GAAGA	1 cut(s)	181
MluCI	AATT	3 cut(s)	95, 112, 118
MnlI	CCTC	4 cut(s)	15, 119, 186, 219
MseI	TTAA	3 cut(s)	26, 38, 212
Mva1269I	GAATGC	1 cut(s)	96
NdeII	GATC	2 cut(s)	138, 171
PctI	GAATGC	1 cut(s)	96
RsaI	GTAC	2 cut(s)	147, 230
RsaNI	GTAC	2 cut(s)	146, 229
SaqAI	TTAA	3 cut(s)	26, 38, 212
Sau3AI	GATC	2 cut(s)	138, 171
ScaI	AGTACT	1 cut(s)	147
SetI	ASST	5 cut(s)	26, 186, 203, 225, 230
SgeI	CNNG	9 cut(s)	14, 24, 81, 88, 92, 112, 202, 235, 247
SmlI	CTYRAG	1 cut(s)	190
SmoI	CTYRAG	1 cut(s)	190
Sse9I	AATT	3 cut(s)	95, 112, 118
SsiI	CCGC	1 cut(s)	32
SspI	AATATT	1 cut(s)	273
SspMI	CTAG	2 cut(s)	2, 100
TaiI	ACGT	1 cut(s)	203
TasI	AATT	3 cut(s)	95, 112, 118
TatI	WGTACW	1 cut(s)	145
Tru1I	TTAA	3 cut(s)	26, 38, 212
Tru9I	TTAA	3 cut(s)	26, 38, 212
TspDTI	ATGAA	1 cut(s)	182
XapI	RAATTY	1 cut(s)	118
XspI	CTAG	2 cut(s)	2, 100
ZrmI	AGTACT	1 cut(s)	147

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.