Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0026100.1

Orthogroup ID

OG0006506

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1466

Gene Structure 1466 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0026100.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 329 bp

tgtgcgagaaagtggagagcaagggaagaaccacttataacgaggttgcagatgaacttgtagcagagttttctgaccctatcaatggtgttacatctcctgatcagcaacaatatgatgagaagaacatcaggcggagggtatatgatgccctgaatgttctaatggcaatggatattatatccaaggataaaaaggaaatacaatggaagggtctgcctcgaaccagccttaatgatattgaagaactgaagactgagcgcctaggactaaggggtaggattgaaaagaaagctgtctatctgcaagaactagaggaacaagtatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000082 GO:0000278 GO:0000981 GO:0003674 GO:0003700 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0006139 GO:0006259 GO:0006260 GO:0006261 GO:0006355 GO:0006357 GO:0006725 GO:0006807 GO:0007049 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009889 GO:0009987 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0022402 GO:0031323 GO:0031326 GO:0034641 GO:0034645 GO:0042023 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044424 GO:0044464 GO:0044770 GO:0044772 GO:0044786 GO:0044843 GO:0046483 GO:0046982 GO:0046983 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0071704 GO:0080090 GO:0090304 GO:0140110 GO:1901360 GO:1901576 GO:1903047 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

ko04110 ko04350 map04110 map04350

Pfam Domains

Protein Families

DP E2F_TDP

Protein Analysis

108

Amino Acids

12.56

Weight (kDa)

4.99

Isoelectric Point (pI)

55.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006506)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G02470 AT5G02470 AT5G02470
fragaria_vesca	FvH4_6g14010 FvH4_6g14010 FvH4_6g14010 FvH4_6g14010 FvH4_6g14010 FvH4_6g14010 FvH4_6g14010
malus_domestica	MD04G1126400.v1.1
prunus_persica	Prupe.6G253200_v2.0.a1 Prupe.6G253200_v2.0.a1
pyrus_communis	pycom04g11340
rosa_chinensis	RchiOBHm_Chr3g0466841
rosa_laevigata	RLG00000024547
rosa_multiflora	Rmu_sc0026100.1_g000001
rosa_roxburghii	Rroxscaffold_6G00414090
rosa_rugosa	Rorug03G0083900 Rorug03G0084000 Rorug03G0084100
rosa_samantha	Rh3AG131700 Rh3BG152800 Rh3CG153000 Rh3DG153900
rosa_wichuraiana	Rw3G012450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	38
AciI	CCGC	1 cut(s)	135
AcuI	CTGAAG	1 cut(s)	271
AfiI	CCNNNNNNNGG	1 cut(s)	85
AgsI	TTSAA	2 cut(s)	244, 286
AluBI	AGCT	1 cut(s)	295
AluI	AGCT	1 cut(s)	295
AspA2I	CCTAGG	1 cut(s)	264
AspLEI	GCGC	1 cut(s)	263
AvrII	CCTAGG	1 cut(s)	264
BbsI	GAAGAC	1 cut(s)	259
BclI	TGATCA	1 cut(s)	102
BfaI	CTAG	2 cut(s)	265, 313
BfoI	RGCGCY	1 cut(s)	264
BlnI	CCTAGG	1 cut(s)	264
BmsI	GCATC	1 cut(s)	138
BpiI	GAAGAC	1 cut(s)	259
BsaJI	CCNNGG	2 cut(s)	185, 264
Bsc4I	CCNNNNNNNGG	1 cut(s)	85
Bse3DI	GCAATG	1 cut(s)	176
BseDI	CCNNGG	2 cut(s)	185, 264
BseLI	CCNNNNNNNGG	1 cut(s)	85
BseMI	GCAATG	1 cut(s)	176
BseMII	CTCAG	1 cut(s)	248
BslI	CCNNNNNNNGG	1 cut(s)	85
Bsp143I	GATC	1 cut(s)	102
BspACI	CCGC	1 cut(s)	135
BspCNI	CTCAG	1 cut(s)	249
BsrDI	GCAATG	1 cut(s)	176
BssECI	CCNNGG	2 cut(s)	185, 264
BssMI	GATC	1 cut(s)	102
BssT1I	CCWWGG	2 cut(s)	185, 264
BstDEI	CTNAG	2 cut(s)	257, 271
BstH2I	RGCGCY	1 cut(s)	264
BstHHI	GCGC	1 cut(s)	263
BstKTI	GATC	1 cut(s)	105
BstMBI	GATC	1 cut(s)	102
BstV2I	GAAGAC	1 cut(s)	259
CfoI	GCGC	1 cut(s)	263
CviJI	RGCY	2 cut(s)	230, 295
CviKI_1	RGCY	2 cut(s)	230, 295
DdeI	CTNAG	2 cut(s)	257, 271
DpnI	GATC	1 cut(s)	104
DpnII	GATC	1 cut(s)	102
EciI	GGCGGA	1 cut(s)	150
Eco130I	CCWWGG	2 cut(s)	185, 264
Eco57I	CTGAAG	1 cut(s)	271
EcoT14I	CCWWGG	2 cut(s)	185, 264
ErhI	CCWWGG	2 cut(s)	185, 264
FaiI	YATR	6 cut(s)	38, 116, 144, 146, 181, 327
FalI	AAGNNNNNCTT	2 cut(s)	18, 50
FbaI	TGATCA	1 cut(s)	102
FspBI	CTAG	2 cut(s)	265, 313
GlaI	GCGC	1 cut(s)	262
HaeII	RGCGCY	1 cut(s)	264
HhaI	GCGC	1 cut(s)	263
Hin6I	GCGC	1 cut(s)	261
HinP1I	GCGC	1 cut(s)	261
Hpy188I	TCNGA	1 cut(s)	75
Hpy188III	TCNNGA	1 cut(s)	100
HpyAV	CCTTC	1 cut(s)	204
HpyCH4V	TGCA	2 cut(s)	49, 306
HpyF3I	CTNAG	2 cut(s)	257, 271
HspAI	GCGC	1 cut(s)	261
Ksp22I	TGATCA	1 cut(s)	102
Kzo9I	GATC	1 cut(s)	102
LpnPI	CCDG	4 cut(s)	113, 117, 166, 240
LweI	GCATC	1 cut(s)	138
MaeI	CTAG	2 cut(s)	265, 313
MaeIII	GTNAC	1 cut(s)	90
MalI	GATC	1 cut(s)	104
MboI	GATC	1 cut(s)	102
MboII	GAAGA	4 cut(s)	38, 135, 256, 264
MnlI	CCTC	4 cut(s)	36, 131, 230, 309
MseI	TTAA	1 cut(s)	233
NdeII	GATC	1 cut(s)	102
PsiI	TTATAA	1 cut(s)	38
SaqAI	TTAA	1 cut(s)	233
Sau3AI	GATC	1 cut(s)	102
SetI	ASST	2 cut(s)	47, 297
SfaNI	GCATC	1 cut(s)	138
SsiI	CCGC	1 cut(s)	135
SspMI	CTAG	2 cut(s)	265, 313
StyI	CCWWGG	2 cut(s)	185, 264
TaqI	TCGA	1 cut(s)	222
Tru1I	TTAA	1 cut(s)	233
Tru9I	TTAA	1 cut(s)	233
TspDTI	ATGAA	1 cut(s)	68
XmaJI	CCTAGG	1 cut(s)	264
XspI	CTAG	2 cut(s)	265, 313

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.