Rmu_sc0027143.1_g000001

Protein CHAPERONE-LIKE PROTEIN OF POR1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0027143.1
Physical Location & Seq
Forward (+)
1594 .. 3205
1612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0027143.1_g000001.1.cds

Sequence Viewer

Length: 855 bp
atggcagccactctctccgtccggccccaccgcttctccgccggctcctccttccctcgccctccggtccgccgacccggcccggcccgcatccgaaaacccgacgaccaattcgaaccctggagaggctcaatcactctctcccgccgcccattagccccggcggtccaagccagctccagagccgacgactcggttcccttcgagatgtcggtggagaacgccctcaagctcctcggagtcgccgacggcgcgtcgttcgatgaaatacttcgcgccaagaaaaacatcgtcgcttcctgtaaggatgaccaggaggcgattgcaagggttgaggctgcatacgacatgttacttatgagaagcttaactcagcggcgggctggcaaagttgtaaatagtagcgttcgttacgctgatgtaaagccggtgaatgctcctccaatgccacagtggctgcaggctactgttaagaatccacctattgcggttgaaacaccctcgacaagtgatctgggtgtacaagttggtgtgtatggagctttgatggccttaacttatgtcaatggaacttcgacttcttctttgccatatggaggggctgatgttcctggactgatcctggctggtagctttggagcttccttgtacttcatgactaaaaagaatattaagttagggaaggctactatcataactatagggggacttgcggctggtgcagtagttggttcagtagtagagaattggctgcaggtagacattgttccatttcttggcatacactctcctgctgctgtagtaagcgaatttattcttttctcgcaattattggtctccctatatttgagatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

284

Amino Acids

30.32

Weight (kDa)

9.67

Isoelectric Point (pI)

48.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 745
AccB7I CCANNNNNTGG 1 cut(s) 776
AccI GTMKAC 1 cut(s) 759
AccII CGCG 2 cut(s) 254, 276
AclWI GGATC 1 cut(s) 613
AcsI RAATTY 1 cut(s) 809
AfaI GTAC 2 cut(s) 522, 650
AfiI CCNNNNNNNGG 3 cut(s) 125, 596, 776
AflIII ACRYGT 1 cut(s) 348
AgsI TTSAA 1 cut(s) 494
AhdI GACNNNNNGTC 1 cut(s) 253
AjnI CCWGG 4 cut(s) 119, 312, 610, 621
AluBI AGCT 6 cut(s) 177, 232, 366, 542, 633, 641
AluI AGCT 6 cut(s) 177, 232, 366, 542, 633, 641
Alw26I GTCTC 1 cut(s) 841
AlwI GGATC 1 cut(s) 613
AlwNI CAGNNNCTG 1 cut(s) 457
AoxI GGCC 4 cut(s) 23, 79, 84, 549
ApeKI GCWGC 5 cut(s) 5, 338, 457, 751, 794
ApoI RAATTY 1 cut(s) 809
ArsI GACNNNNNNTTYG 4 cut(s) 95, 127, 568, 600
Asp700I GAANNNNTTC 2 cut(s) 270, 813
AspLEI GCGC 2 cut(s) 254, 278
AspS9I GGNCC 5 cut(s) 24, 67, 80, 85, 166
AsuC2I CCSGG 3 cut(s) 78, 83, 161
AsuHPI GGTGA 1 cut(s) 442
AsuII TTCGAA 1 cut(s) 114
AvaII GGWCC 2 cut(s) 67, 166
BbvI GCAGC 5 cut(s) 17, 325, 444, 738, 781
BccI CCATC 1 cut(s) 541
BceAI ACGGC 1 cut(s) 265
BciT130I CCWGG 4 cut(s) 121, 314, 612, 623
BcnI CCSGG 3 cut(s) 78, 83, 161
BcoDI GTCTC 1 cut(s) 841
BfmI CTRYAG 4 cut(s) 458, 699, 752, 798
BfuAI ACCTGC 1 cut(s) 745
BglI GCCNNNNNGGC 2 cut(s) 78, 454
BisI GCNGC 8 cut(s) 6, 148, 339, 377, 458, 714, 752, 795
BlsI GCNGC 8 cut(s) 7, 149, 340, 378, 459, 715, 753, 796
Bme1390I CCNGG 7 cut(s) 78, 83, 121, 161, 314, 612, 623
Bme18I GGWCC 2 cut(s) 67, 166
BmeRI GACNNNNNGTC 1 cut(s) 253
BmgT120I GGNCC 5 cut(s) 24, 67, 80, 85, 166
BmiI GGNNCC 3 cut(s) 26, 46, 198
BmrFI CCNGG 7 cut(s) 78, 83, 121, 161, 314, 612, 623
BmsI GCATC 1 cut(s) 99
BpmI CTGGAG 2 cut(s) 142, 163
Bpu14I TTCGAA 1 cut(s) 114
BpuEI CTTGAG 1 cut(s) 212
BpuMI CCSGG 3 cut(s) 78, 83, 161
BsaI GGTCTC 1 cut(s) 841
BsaJI CCNNGG 3 cut(s) 119, 159, 235
BsaWI WCCGGW 1 cut(s) 64
BsaXI ACNNNNNCTCC 2 cut(s) 20, 50
Bsc4I CCNNNNNNNGG 3 cut(s) 125, 596, 776
Bse118I RCCGGY 2 cut(s) 41, 427
BseBI CCWGG 4 cut(s) 121, 314, 612, 623
BseDI CCNNGG 3 cut(s) 119, 159, 235
BseGI GGATG 2 cut(s) 90, 313
BseLI CCNNNNNNNGG 3 cut(s) 125, 596, 776
BseMII CTCAG 1 cut(s) 386
BseRI GAGGAG 3 cut(s) 37, 224, 429
BseXI GCAGC 5 cut(s) 17, 325, 444, 738, 781
BsgI GTGCAG 1 cut(s) 741
Bsh1236I CGCG 2 cut(s) 254, 276
BshFI GGCC 4 cut(s) 25, 81, 86, 551
BsiSI CCGG 7 cut(s) 22, 42, 65, 78, 83, 161, 428
BslFI GGGAC 1 cut(s) 720
BslI CCNNNNNNNGG 3 cut(s) 125, 596, 776
BsmAI GTCTC 1 cut(s) 841
BsmFI GGGAC 1 cut(s) 720
BsmI GAATGC 1 cut(s) 439
BsnI GGCC 4 cut(s) 25, 81, 86, 551
Bso31I GGTCTC 1 cut(s) 841
Bsp119I TTCGAA 1 cut(s) 114
Bsp1407I TGTACA 1 cut(s) 520
Bsp143I GATC 2 cut(s) 511, 618
BspANI GGCC 4 cut(s) 25, 81, 86, 551
BspCNI CTCAG 1 cut(s) 385
BspFNI CGCG 2 cut(s) 254, 276
BspHI TCATGA 1 cut(s) 654
BspLI GGNNCC 3 cut(s) 26, 46, 198
BspMAI CTGCAG 2 cut(s) 462, 756
BspMI ACCTGC 1 cut(s) 745
BspPI GGATC 1 cut(s) 613
BspT104I TTCGAA 1 cut(s) 114
BspTNI GGTCTC 1 cut(s) 841
BsrFI RCCGGY 2 cut(s) 41, 427
BsrGI TGTACA 1 cut(s) 520
BssAI RCCGGY 2 cut(s) 41, 427
BssECI CCNNGG 3 cut(s) 119, 159, 235
BssMI GATC 2 cut(s) 511, 618
Bst2UI CCWGG 4 cut(s) 121, 314, 612, 623
Bst4CI ACNGT 2 cut(s) 453, 469
BstAUI TGTACA 1 cut(s) 520
BstBI TTCGAA 1 cut(s) 114
BstC8I GCNNGC 6 cut(s) 43, 88, 175, 381, 385, 462
BstDEI CTNAG 1 cut(s) 372
BstF5I GGATG 2 cut(s) 90, 313
BstFNI CGCG 2 cut(s) 254, 276
BstHHI GCGC 2 cut(s) 254, 278
BstKTI GATC 2 cut(s) 514, 621
BstMAI GTCTC 1 cut(s) 841
BstMBI GATC 2 cut(s) 511, 618
BstMWI GCNNNNNNNGC 7 cut(s) 78, 87, 170, 251, 454, 548, 719
BstNI CCWGG 4 cut(s) 121, 314, 612, 623
BstNSI RCATGY 1 cut(s) 352
BstSCI CCNGG 7 cut(s) 76, 81, 119, 159, 312, 610, 621
BstSFI CTRYAG 4 cut(s) 458, 699, 752, 798
BstUI CGCG 2 cut(s) 254, 276
BstV1I GCAGC 5 cut(s) 17, 325, 444, 738, 781
BsuRI GGCC 4 cut(s) 25, 81, 86, 551
BtsCI GGATG 2 cut(s) 90, 313
BtsIMutI CAGTG 1 cut(s) 458
BveI ACCTGC 1 cut(s) 745
Cac8I GCNNGC 6 cut(s) 43, 88, 175, 381, 385, 462
CaiI CAGNNNCTG 1 cut(s) 457
CciI TCATGA 1 cut(s) 654
CfoI GCGC 2 cut(s) 254, 278
Cfr10I RCCGGY 2 cut(s) 41, 427
Cfr13I GGNCC 5 cut(s) 24, 67, 80, 85, 166
CpoI CGGWCCG 1 cut(s) 67
CseI GACGC 1 cut(s) 243
Csp6I GTAC 2 cut(s) 521, 649
CspI CGGWCCG 1 cut(s) 67
CviAII CATG 2 cut(s) 349, 655
CviQI GTAC 2 cut(s) 521, 649
DdeI CTNAG 1 cut(s) 372
DpnI GATC 2 cut(s) 513, 620
DpnII GATC 2 cut(s) 511, 618
DriI GACNNNNNGTC 1 cut(s) 253
Eam1105I GACNNNNNGTC 1 cut(s) 253
EciI GGCGGA 2 cut(s) 28, 59
Eco31I GGTCTC 1 cut(s) 841
Eco47I GGWCC 2 cut(s) 67, 166
EcoRII CCWGG 4 cut(s) 119, 312, 610, 621
FaeI CATG 2 cut(s) 352, 658
FaqI GGGAC 1 cut(s) 720
FatI CATG 2 cut(s) 348, 654
FauI CCCGC 3 cut(s) 95, 152, 372
FauNDI CATATG 1 cut(s) 592
FblI GTMKAC 1 cut(s) 759
Fnu4HI GCNGC 8 cut(s) 6, 148, 339, 377, 458, 714, 752, 795
FokI GGATG 2 cut(s) 77, 320
Fsp4HI GCNGC 8 cut(s) 6, 148, 339, 377, 458, 714, 752, 795
GlaI GCGC 2 cut(s) 253, 277
GluI GCNGC 8 cut(s) 6, 148, 339, 377, 458, 714, 752, 795
GsuI CTGGAG 2 cut(s) 142, 163
HaeIII GGCC 4 cut(s) 25, 81, 86, 551
HapII CCGG 7 cut(s) 22, 42, 65, 78, 83, 161, 428
HgaI GACGC 1 cut(s) 243
HhaI GCGC 2 cut(s) 254, 278
Hin1II CATG 2 cut(s) 352, 658
Hin6I GCGC 2 cut(s) 252, 276
HinP1I GCGC 2 cut(s) 252, 276
HindIII AAGCTT 1 cut(s) 364
HinfI GANTC 3 cut(s) 191, 240, 475
HpaII CCGG 7 cut(s) 22, 42, 65, 78, 83, 161, 428
HphI GGTGA 1 cut(s) 442
Hpy166II GTNNAC 2 cut(s) 521, 760
Hpy188I TCNGA 2 cut(s) 95, 239
Hpy188III TCNNGA 3 cut(s) 180, 205, 655
Hpy8I GTNNAC 2 cut(s) 521, 760
Hpy99I CGWCG 5 cut(s) 107, 191, 251, 259, 296
HpyAV CCTTC 3 cut(s) 61, 211, 676
HpyCH4III ACNGT 2 cut(s) 453, 469
HpyCH4V TGCA 5 cut(s) 326, 341, 460, 722, 754
HpyF10VI GCNNNNNNNGC 7 cut(s) 78, 87, 170, 251, 454, 548, 719
HpyF3I CTNAG 1 cut(s) 372
Hsp92II CATG 2 cut(s) 352, 658
HspAI GCGC 2 cut(s) 252, 276
KroI GCCGGC 1 cut(s) 41
KroNI GCCGGC 1 cut(s) 43
Kzo9I GATC 2 cut(s) 511, 618
LmnI GCTCC 6 cut(s) 50, 182, 237, 442, 539, 638
Lsp1109I GCAGC 5 cut(s) 17, 325, 444, 738, 781
LweI GCATC 1 cut(s) 99
MaeIII GTNAC 2 cut(s) 351, 410
MalI GATC 2 cut(s) 513, 620
MboI GATC 2 cut(s) 511, 618
MboII GAAGA 1 cut(s) 573
MluCI AATT 4 cut(s) 110, 745, 809, 827
MlyI GAGTC 2 cut(s) 185, 249
MroNI GCCGGC 1 cut(s) 41
MroXI GAANNNNTTC 2 cut(s) 270, 813
MseI TTAA 4 cut(s) 368, 471, 554, 672
MspA1I CMGCKG 1 cut(s) 376
MspI CCGG 7 cut(s) 22, 42, 65, 78, 83, 161, 428
MspR9I CCNGG 7 cut(s) 78, 83, 121, 161, 314, 612, 623
Mva1269I GAATGC 1 cut(s) 439
MvaI CCWGG 4 cut(s) 121, 314, 612, 623
MvnI CGCG 2 cut(s) 254, 276
MwoI GCNNNNNNNGC 7 cut(s) 78, 87, 170, 251, 454, 548, 719
NaeI GCCGGC 1 cut(s) 43
NciI CCSGG 3 cut(s) 78, 83, 161
NdeI CATATG 1 cut(s) 592
NdeII GATC 2 cut(s) 511, 618
NgoMIV GCCGGC 1 cut(s) 41
NlaIII CATG 2 cut(s) 352, 658
NlaIV GGNNCC 3 cut(s) 26, 46, 198
NspI RCATGY 1 cut(s) 352
NspV TTCGAA 1 cut(s) 114
PagI TCATGA 1 cut(s) 654
PciI ACATGT 1 cut(s) 348
PcsI WCGNNNNNNNCGW 2 cut(s) 111, 243
PctI GAATGC 1 cut(s) 439
PdiI GCCGGC 1 cut(s) 43
PdmI GAANNNNTTC 2 cut(s) 270, 813
PfeI GAWTC 1 cut(s) 475
PflMI CCANNNNNTGG 1 cut(s) 776
PfoI TCCNGGA 1 cut(s) 610
PkrI GCNGC 8 cut(s) 7, 149, 340, 378, 459, 715, 753, 796
PleI GAGTC 2 cut(s) 185, 248
PpsI GAGTC 2 cut(s) 185, 248
PscI ACATGT 1 cut(s) 348
Psp6I CCWGG 4 cut(s) 119, 312, 610, 621
PspGI CCWGG 4 cut(s) 119, 312, 610, 621
PspN4I GGNNCC 3 cut(s) 26, 46, 198
PspPI GGNCC 5 cut(s) 24, 67, 80, 85, 166
PsrI GAACNNNNNNTAC 2 cut(s) 750, 782
PstI CTGCAG 2 cut(s) 462, 756
PstNI CAGNNNCTG 1 cut(s) 457
RsaI GTAC 2 cut(s) 522, 650
RsaNI GTAC 2 cut(s) 521, 649
Rsr2I CGGWCCG 1 cut(s) 67
RsrII CGGWCCG 1 cut(s) 67
SaqAI TTAA 4 cut(s) 368, 471, 554, 672
SatI GCNGC 8 cut(s) 6, 148, 339, 377, 458, 714, 752, 795
Sau3AI GATC 2 cut(s) 511, 618
Sau96I GGNCC 5 cut(s) 24, 67, 80, 85, 166
SchI GAGTC 2 cut(s) 185, 249
ScrFI CCNGG 7 cut(s) 78, 83, 121, 161, 314, 612, 623
SetI ASST 8 cut(s) 179, 234, 368, 484, 544, 635, 643, 759
SfaNI GCATC 1 cut(s) 99
SfcI CTRYAG 4 cut(s) 458, 699, 752, 798
SfuI TTCGAA 1 cut(s) 114
SinI GGWCC 2 cut(s) 67, 166
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 4 cut(s) 110, 745, 809, 827
SspI AATATT 1 cut(s) 670
StyD4I CCNGG 7 cut(s) 76, 81, 119, 159, 312, 610, 621
TaaI ACNGT 2 cut(s) 453, 469
TaqI TCGA 5 cut(s) 114, 204, 261, 503, 575
TasI AATT 4 cut(s) 110, 745, 809, 827
TatI WGTACW 2 cut(s) 520, 648
TauI GCSGC 3 cut(s) 150, 379, 716
TfiI GAWTC 1 cut(s) 475
Tru1I TTAA 4 cut(s) 368, 471, 554, 672
Tru9I TTAA 4 cut(s) 368, 471, 554, 672
TscAI CASTG 1 cut(s) 458
TseI GCWGC 5 cut(s) 5, 338, 457, 751, 794
TspDTI ATGAA 2 cut(s) 279, 643
TspGWI ACGGA 1 cut(s) 7
TspRI CASTG 1 cut(s) 458
Van91I CCANNNNNTGG 1 cut(s) 776
VpaK11BI GGWCC 2 cut(s) 67, 166
XapI RAATTY 1 cut(s) 809
XceI RCATGY 1 cut(s) 352
XcmI CCANNNNNNNNNTGG 1 cut(s) 450
XmiI GTMKAC 1 cut(s) 759
XmnI GAANNNNTTC 2 cut(s) 270, 813
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.