Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028874.1

Orthogroup ID

OG0009637

Physical Location & Seq

Genomic Coordinates Forward (+)

1176 .. 2126

Gene Structure 951 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028874.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 846 bp

ctggaaaccattagagaatcttcactttcggtccgaactacgagccaaggcaagcaatggagtgatgggcaggtcctatacaagatgtcccccagaactgcccaaatccgtcttgtcagctcacatcgcgaggtttatgaaccgtgcgatgattcatttgctttagtagatgctcttttggctgatcaagcaaacctgttacagcatcaaccaaaattgtgcctggaactgggctgtggtagtggctatgttattacttctctagctcttattcttggcaaggaggggcactatattgcaactgatatcaacccccatgcggtgagagtgactcaggagacgctagaagcacacggggttcatgcagaattgataaacactaacattgcatcaggacttgagaagcgtctggcaggattagttgatgtaatagttgtgaacccgccttatgtgccaactcctgaagatgaagtgggtcgtgaagggattgcatctgcttgggctggcggagagaatggtcgtgctgtgattgataagatactgcctgttgccgataatcttttgtcagagaaaggctggttgtatatggtcacgctttcagaaaacaatccatcagagatatgccttcaaatgagagagaagggctatgcttccagaatccttgtccagagattgacagacgaagaaagtctccagatcatcaagttctggcgggattttgattctcaattagaagagaaggagatggcagaaaacaaaacagttccgtcaagggtcatggagtctttgctctctcaatttcctagaatgccatttttgagaggcaataacagcaacagtagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MTS

Protein Analysis

281

Amino Acids

31.2

Weight (kDa)

5.1

Isoelectric Point (pI)

45.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009637)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G13440 AT3G13440 AT3G13440
fragaria_vesca	FvH4_3g13390 FvH4_3g13390
malus_domestica	MD05G1242200.v1.1
prunus_persica	Prupe.4G121300_v2.0.a1 Prupe.4G121300_v2.0.a1 Prupe.4G121300_v2.0.a1
pyrus_communis	pycom05g21870
rosa_chinensis	RchiOBHm_Chr5g0022101
rosa_laevigata	RLG00000032644
rosa_multiflora	Rmu_co8399787.1_g000001 Rmu_sc0026188.1_g000002 Rmu_sc0028874.1_g000002
rosa_roxburghii	Rroxscaffold_1G00056830
rosa_rugosa	Rorug05G0071300 Rorug05G0071400
rosa_samantha	Rh5BG158500 Rh5CG172900 Rh5DG158700
rosa_wichuraiana	Rw5G014210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	61
AccII	CGCG	1 cut(s)	129
AciI	CCGC	4 cut(s)	320, 443, 507, 712
AcuI	CTGAAG	1 cut(s)	483
AfiI	CCNNNNNNNGG	2 cut(s)	229, 319
AgsI	TTSAA	1 cut(s)	629
AjnI	CCWGG	1 cut(s)	222
AluBI	AGCT	3 cut(s)	120, 266, 843
AluI	AGCT	3 cut(s)	120, 266, 843
Alw26I	GTCTC	2 cut(s)	332, 695
AlwNI	CAGNNNCTG	1 cut(s)	843
AspS9I	GGNCC	2 cut(s)	31, 73
AsuHPI	GGTGA	1 cut(s)	334
AvaII	GGWCC	2 cut(s)	31, 73
BaeGI	GKGCMC	1 cut(s)	291
BccI	CCATC	3 cut(s)	59, 619, 739
BciT130I	CCWGG	1 cut(s)	224
BclI	TGATCA	1 cut(s)	184
BcoDI	GTCTC	2 cut(s)	332, 695
BfaI	CTAG	3 cut(s)	263, 344, 804
BfuAI	ACCTGC	1 cut(s)	61
Bme1390I	CCNGG	1 cut(s)	224
Bme18I	GGWCC	2 cut(s)	31, 73
BmgT120I	GGNCC	2 cut(s)	31, 73
BmrFI	CCNGG	1 cut(s)	224
BmrI	ACTGGG	1 cut(s)	239
BmsI	GCATC	4 cut(s)	160, 214, 398, 500
BmuI	ACTGGG	1 cut(s)	239
BplI	GAGNNNNNCTC	2 cut(s)	316, 348
BpmI	CTGGAG	1 cut(s)	677
BpuEI	CTTGAG	1 cut(s)	419
BsaJI	CCNNGG	1 cut(s)	46
Bsc4I	CCNNNNNNNGG	2 cut(s)	229, 319
Bse1I	ACTGG	1 cut(s)	234
Bse3DI	GCAATG	2 cut(s)	62, 384
BseBI	CCWGG	1 cut(s)	224
BseDI	CCNNGG	1 cut(s)	46
BseLI	CCNNNNNNNGG	2 cut(s)	229, 319
BseMI	GCAATG	2 cut(s)	62, 384
BseMII	CTCAG	1 cut(s)	347
BseNI	ACTGG	1 cut(s)	234
BseSI	GKGCMC	1 cut(s)	291
Bsh1236I	CGCG	1 cut(s)	129
BslFI	GGGAC	1 cut(s)	73
BslI	CCNNNNNNNGG	2 cut(s)	229, 319
BsmAI	GTCTC	2 cut(s)	332, 695
BsmBI	CGTCTC	1 cut(s)	332
BsmFI	GGGAC	1 cut(s)	73
BsmI	GAATGC	1 cut(s)	813
Bsp1286I	GDGCHC	1 cut(s)	291
Bsp143I	GATC	2 cut(s)	184, 696
Bsp68I	TCGCGA	1 cut(s)	129
BspACI	CCGC	4 cut(s)	320, 443, 507, 712
BspCNI	CTCAG	1 cut(s)	346
BspFNI	CGCG	1 cut(s)	129
BspMI	ACCTGC	1 cut(s)	61
BsrDI	GCAATG	2 cut(s)	62, 384
BsrI	ACTGG	1 cut(s)	234
BssECI	CCNNGG	1 cut(s)	46
BssMI	GATC	2 cut(s)	184, 696
BssT1I	CCWWGG	1 cut(s)	46
Bst2UI	CCWGG	1 cut(s)	224
Bst4CI	ACNGT	3 cut(s)	144, 763, 839
Bst6I	CTCTTC	1 cut(s)	729
BstC8I	GCNNGC	2 cut(s)	53, 505
BstDEI	CTNAG	1 cut(s)	333
BstFNI	CGCG	1 cut(s)	129
BstKTI	GATC	2 cut(s)	187, 699
BstMAI	GTCTC	2 cut(s)	332, 695
BstMBI	GATC	2 cut(s)	184, 696
BstMWI	GCNNNNNNNGC	6 cut(s)	126, 179, 188, 451, 831, 840
BstNI	CCWGG	1 cut(s)	224
BstSCI	CCNGG	1 cut(s)	222
BstSLI	GKGCMC	1 cut(s)	291
BstUI	CGCG	1 cut(s)	129
BtgZI	GCGATG	2 cut(s)	110, 162
BtuMI	TCGCGA	1 cut(s)	129
BveI	ACCTGC	1 cut(s)	61
Cac8I	GCNNGC	2 cut(s)	53, 505
CaiI	CAGNNNCTG	1 cut(s)	843
Cfr13I	GGNCC	2 cut(s)	31, 73
CpoI	CGGWCCG	1 cut(s)	31
CseI	GACGC	2 cut(s)	349, 395
CspI	CGGWCCG	1 cut(s)	31
CviAII	CATG	3 cut(s)	317, 362, 778
DdeI	CTNAG	1 cut(s)	333
DpnI	GATC	2 cut(s)	186, 698
DpnII	GATC	2 cut(s)	184, 696
Eam1104I	CTCTTC	1 cut(s)	729
EarI	CTCTTC	1 cut(s)	729
EciI	GGCGGA	1 cut(s)	522
Eco130I	CCWWGG	1 cut(s)	46
Eco32I	GATATC	1 cut(s)	307
Eco47I	GGWCC	2 cut(s)	31, 73
Eco57I	CTGAAG	1 cut(s)	483
EcoO109I	RGGNCCY	1 cut(s)	73
EcoRII	CCWGG	1 cut(s)	222
EcoRV	GATATC	1 cut(s)	307
EcoT14I	CCWWGG	1 cut(s)	46
ErhI	CCWWGG	1 cut(s)	46
Esp3I	CGTCTC	1 cut(s)	332
FaeI	CATG	3 cut(s)	320, 365, 781
FaqI	GGGAC	1 cut(s)	73
FatI	CATG	3 cut(s)	316, 361, 777
FauI	CCCGC	2 cut(s)	450, 705
FbaI	TGATCA	1 cut(s)	184
FspBI	CTAG	3 cut(s)	263, 344, 804
GsuI	CTGGAG	1 cut(s)	677
HgaI	GACGC	2 cut(s)	349, 395
Hin1II	CATG	3 cut(s)	320, 365, 781
HinfI	GANTC	6 cut(s)	17, 152, 331, 657, 722, 782
HphI	GGTGA	1 cut(s)	334
Hpy166II	GTNNAC	1 cut(s)	439
Hpy188I	TCNGA	4 cut(s)	35, 568, 601, 616
Hpy188III	TCNNGA	8 cut(s)	128, 335, 393, 461, 479, 654, 667, 694
Hpy8I	GTNNAC	1 cut(s)	439
HpyAV	CCTTC	4 cut(s)	476, 634, 635, 733
HpyCH4III	ACNGT	3 cut(s)	144, 763, 839
HpyCH4V	TGCA	4 cut(s)	299, 365, 389, 491
HpyF10VI	GCNNNNNNNGC	6 cut(s)	126, 179, 188, 451, 831, 840
HpyF3I	CTNAG	1 cut(s)	333
Hsp92II	CATG	3 cut(s)	320, 365, 781
Ksp22I	TGATCA	1 cut(s)	184
Kzo9I	GATC	2 cut(s)	184, 696
LweI	GCATC	4 cut(s)	160, 214, 398, 500
MaeI	CTAG	3 cut(s)	263, 344, 804
MaeIII	GTNAC	3 cut(s)	198, 328, 589
MalI	GATC	2 cut(s)	186, 698
MboI	GATC	2 cut(s)	184, 696
MboII	GAAGA	4 cut(s)	12, 476, 695, 746
MhlI	GDGCHC	1 cut(s)	291
MluCI	AATT	4 cut(s)	215, 368, 728, 797
MlyI	GAGTC	2 cut(s)	325, 791
MnlI	CCTC	3 cut(s)	124, 277, 815
MspR9I	CCNGG	1 cut(s)	224
Mva1269I	GAATGC	1 cut(s)	813
MvaI	CCWGG	1 cut(s)	224
MvnI	CGCG	1 cut(s)	129
MwoI	GCNNNNNNNGC	6 cut(s)	126, 179, 188, 451, 831, 840
NdeII	GATC	2 cut(s)	184, 696
NlaIII	CATG	3 cut(s)	320, 365, 781
NmuCI	GTSAC	2 cut(s)	328, 589
NruI	TCGCGA	1 cut(s)	129
PctI	GAATGC	1 cut(s)	813
PfeI	GAWTC	4 cut(s)	17, 152, 657, 722
PleI	GAGTC	2 cut(s)	325, 790
PpsI	GAGTC	2 cut(s)	325, 790
PpuMI	RGGWCCY	1 cut(s)	73
Psp5II	RGGWCCY	1 cut(s)	73
Psp6I	CCWGG	1 cut(s)	222
PspGI	CCWGG	1 cut(s)	222
PspPI	GGNCC	2 cut(s)	31, 73
PspPPI	RGGWCCY	1 cut(s)	73
PstNI	CAGNNNCTG	1 cut(s)	843
RruI	TCGCGA	1 cut(s)	129
Rsr2I	CGGWCCG	1 cut(s)	31
RsrII	CGGWCCG	1 cut(s)	31
Sau3AI	GATC	2 cut(s)	184, 696
Sau96I	GGNCC	2 cut(s)	31, 73
SchI	GAGTC	2 cut(s)	325, 791
ScrFI	CCNGG	1 cut(s)	224
SduI	GDGCHC	1 cut(s)	291
SetI	ASST	6 cut(s)	75, 122, 135, 198, 268, 845
SfaNI	GCATC	4 cut(s)	160, 214, 398, 500
SinI	GGWCC	2 cut(s)	31, 73
SmlI	CTYRAG	1 cut(s)	398
SmoI	CTYRAG	1 cut(s)	398
Sse9I	AATT	4 cut(s)	215, 368, 728, 797
SsiI	CCGC	4 cut(s)	320, 443, 507, 712
SspMI	CTAG	3 cut(s)	263, 344, 804
StyD4I	CCNGG	1 cut(s)	222
StyI	CCWWGG	1 cut(s)	46
TaaI	ACNGT	3 cut(s)	144, 763, 839
TaqII	GACCGA	1 cut(s)	19
TasI	AATT	4 cut(s)	215, 368, 728, 797
TfiI	GAWTC	4 cut(s)	17, 152, 657, 722
TseFI	GTSAC	2 cut(s)	328, 589
Tsp45I	GTSAC	2 cut(s)	328, 589
TspDTI	ATGAA	4 cut(s)	144, 153, 350, 483
TspGWI	ACGGA	2 cut(s)	98, 756
VpaK11BI	GGWCC	2 cut(s)	31, 73
XspI	CTAG	3 cut(s)	263, 344, 804

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.