Rmu_sc0033944.1_g000001

Stromal cell-derived factor 2-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033944.1
Physical Location & Seq
Forward (+)
14 .. 1872
1859 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033944.1_g000001.1.cds

Sequence Viewer

Length: 645 bp
atggccatgggctttctctgcttagctgtcttcctcttcctcggcctcgacctcgacacaggctacgcggccaccacccctacctcagagggcgtcgagatcacatacggaactgtgctcaagctgatgcacgagaggaccaagtttcggctgcactcgcacgacgtgccgtatggctctggcagtggccagcagtccgtcactggatttccaaatgtcgacgatgctaatagctactggattgttggacctcagcttgaaacatctgccaggcaaggtgacagcattccgagtgggacgatcgtcaggttgcaacacatgaggactaggaaatggctgcacagccatttgcacgcatccccgatatcaggcaaccaagagataagctgctttgggggagaacatgaatctgatactggtgatcactggagggttatgattgaaggaagtgggaagacctggaagcaagatcaaagggttcgaattcagcatgttgacactggtgcttacctacacagtcatgacaagaaataccaacgcatagctgggggacagcaggaggtttgtggtgtgagagacaaacgtgctgacaatgtttggctggcagcagaaggtgtataccttccagttactgaaactaagtag

Protein Analysis

214

Amino Acids

23.79

Weight (kDa)

6.44

Isoelectric Point (pI)

30.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012046)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 219, 618
AccII CGCG 1 cut(s) 68
AciI CCGC 1 cut(s) 68
AcoI YGGCCR 3 cut(s) 3, 69, 187
AcsI RAATTY 1 cut(s) 483
AcyI GRCGYC 1 cut(s) 93
AdeI CACNNNGTG 1 cut(s) 166
AfiI CCNNNNNNNGG 2 cut(s) 147, 368
AgsI TTSAA 2 cut(s) 260, 443
AjiI CACGTC 1 cut(s) 166
AjnI CCWGG 2 cut(s) 269, 458
AluBI AGCT 6 cut(s) 26, 124, 234, 256, 387, 545
AluI AGCT 6 cut(s) 26, 124, 234, 256, 387, 545
Alw21I GWGCWC 1 cut(s) 120
Alw26I GTCTC 1 cut(s) 570
AlwNI CAGNNNCTG 1 cut(s) 632
AoxI GGCC 4 cut(s) 3, 43, 69, 187
ApeKI GCWGC 4 cut(s) 151, 337, 387, 605
ApoI RAATTY 1 cut(s) 483
AspS9I GGNCC 2 cut(s) 138, 248
AsuHPI GGTGA 2 cut(s) 290, 431
AsuII TTCGAA 1 cut(s) 481
AvaII GGWCC 2 cut(s) 138, 248
BalI TGGCCA 2 cut(s) 5, 189
BauI CACGAG 1 cut(s) 131
BbsI GAAGAC 2 cut(s) 22, 461
Bbv12I GWGCWC 1 cut(s) 120
BbvCI CCTCAGC 1 cut(s) 252
BbvI GCAGC 4 cut(s) 138, 324, 374, 617
BceAI ACGGC 1 cut(s) 154
BciT130I CCWGG 2 cut(s) 271, 460
BclI TGATCA 1 cut(s) 421
BcoDI GTCTC 1 cut(s) 570
BfaI CTAG 1 cut(s) 327
BisI GCNGC 5 cut(s) 69, 152, 338, 388, 606
BlpI GCTNAGC 1 cut(s) 22
BlsI GCNGC 5 cut(s) 70, 153, 339, 389, 607
Bme1390I CCNGG 2 cut(s) 271, 460
Bme18I GGWCC 2 cut(s) 138, 248
BmgBI CACGTC 1 cut(s) 166
BmgT120I GGNCC 2 cut(s) 138, 248
BmrFI CCNGG 2 cut(s) 271, 460
BmsI GCATC 3 cut(s) 117, 214, 365
BoxI GACNNNNGTC 1 cut(s) 302
BpiI GAAGAC 2 cut(s) 22, 461
BpmI CTGGAG 1 cut(s) 448
Bpu10I CCTNAGC 1 cut(s) 252
Bpu1102I GCTNAGC 1 cut(s) 22
Bpu14I TTCGAA 1 cut(s) 481
BpuEI CTTGAG 1 cut(s) 104
BsaHI GRCGYC 1 cut(s) 93
BsaJI CCNNGG 2 cut(s) 6, 40
Bsc4I CCNNNNNNNGG 2 cut(s) 147, 368
Bse1I ACTGG 6 cut(s) 208, 242, 421, 431, 505, 626
BseBI CCWGG 2 cut(s) 271, 460
BseDI CCNNGG 2 cut(s) 6, 40
BseGI GGATG 1 cut(s) 356
BseLI CCNNNNNNNGG 2 cut(s) 147, 368
BseMII CTCAG 2 cut(s) 99, 266
BseNI ACTGG 6 cut(s) 208, 242, 421, 431, 505, 626
BseXI GCAGC 4 cut(s) 138, 324, 374, 617
BseYI CCCAGC 1 cut(s) 545
BsgI GTGCAG 2 cut(s) 137, 323
Bsh1236I CGCG 1 cut(s) 68
Bsh1285I CGRYCG 1 cut(s) 303
BshFI GGCC 4 cut(s) 5, 45, 71, 189
BsiEI CGRYCG 1 cut(s) 303
BsiHKAI GWGCWC 1 cut(s) 120
BslFI GGGAC 2 cut(s) 310, 564
BslI CCNNNNNNNGG 2 cut(s) 147, 368
BsmAI GTCTC 1 cut(s) 570
BsmFI GGGAC 2 cut(s) 310, 564
BsmI GAATGC 1 cut(s) 285
BsnI GGCC 4 cut(s) 5, 45, 71, 189
Bsp119I TTCGAA 1 cut(s) 481
Bsp1286I GDGCHC 1 cut(s) 120
Bsp143I GATC 4 cut(s) 99, 300, 421, 469
Bsp1720I GCTNAGC 1 cut(s) 22
Bsp19I CCATGG 1 cut(s) 6
BspACI CCGC 1 cut(s) 68
BspANI GGCC 4 cut(s) 5, 45, 71, 189
BspCNI CTCAG 2 cut(s) 98, 265
BspFNI CGCG 1 cut(s) 68
BspHI TCATGA 1 cut(s) 520
BspT104I TTCGAA 1 cut(s) 481
BsrI ACTGG 6 cut(s) 208, 242, 421, 431, 505, 626
BssECI CCNNGG 2 cut(s) 6, 40
BssMI GATC 4 cut(s) 99, 300, 421, 469
BssNAI GTATAC 1 cut(s) 619
BssNI GRCGYC 1 cut(s) 93
BssSI CACGAG 1 cut(s) 131
BssT1I CCWWGG 1 cut(s) 6
Bst1107I GTATAC 1 cut(s) 619
Bst2BI CACGAG 1 cut(s) 131
Bst2UI CCWGG 2 cut(s) 271, 460
Bst4CI ACNGT 2 cut(s) 115, 518
Bst6I CTCTTC 1 cut(s) 41
BstACI GRCGYC 1 cut(s) 93
BstAPI GCANNNNNTGC 1 cut(s) 166
BstBI TTCGAA 1 cut(s) 481
BstC8I GCNNGC 3 cut(s) 191, 354, 603
BstDEI CTNAG 4 cut(s) 22, 85, 252, 639
BstDSI CCRYGG 1 cut(s) 6
BstF5I GGATG 1 cut(s) 356
BstFNI CGCG 1 cut(s) 68
BstKTI GATC 4 cut(s) 102, 303, 424, 472
BstMAI GTCTC 1 cut(s) 570
BstMBI GATC 4 cut(s) 99, 300, 421, 469
BstMCI CGRYCG 1 cut(s) 303
BstMWI GCNNNNNNNGC 3 cut(s) 18, 157, 166
BstNI CCWGG 2 cut(s) 271, 460
BstNSI RCATGY 1 cut(s) 494
BstPAI GACNNNNGTC 1 cut(s) 302
BstSCI CCNGG 2 cut(s) 269, 458
BstUI CGCG 1 cut(s) 68
BstV1I GCAGC 4 cut(s) 138, 324, 374, 617
BstV2I GAAGAC 2 cut(s) 22, 461
BstZ17I GTATAC 1 cut(s) 619
BsuRI GGCC 4 cut(s) 5, 45, 71, 189
BtgI CCRYGG 1 cut(s) 6
BtrI CACGTC 1 cut(s) 166
BtsCI GGATG 1 cut(s) 356
BtsI GCAGTG 1 cut(s) 190
BtsIMutI CAGTG 4 cut(s) 190, 201, 424, 498
Cac8I GCNNGC 3 cut(s) 191, 354, 603
CaiI CAGNNNCTG 1 cut(s) 632
CciI TCATGA 1 cut(s) 520
Cfr13I GGNCC 2 cut(s) 138, 248
CseI GACGC 1 cut(s) 82
CviAII CATG 5 cut(s) 7, 319, 404, 491, 521
DdeI CTNAG 4 cut(s) 22, 85, 252, 639
DpnI GATC 4 cut(s) 101, 302, 423, 471
DpnII GATC 4 cut(s) 99, 300, 421, 469
DraIII CACNNNGTG 1 cut(s) 166
EaeI YGGCCR 3 cut(s) 3, 69, 187
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Eco130I CCWWGG 1 cut(s) 6
Eco32I GATATC 1 cut(s) 366
Eco47I GGWCC 2 cut(s) 138, 248
EcoRI GAATTC 1 cut(s) 483
EcoRII CCWGG 2 cut(s) 269, 458
EcoRV GATATC 1 cut(s) 366
EcoT14I CCWWGG 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 6
FaeI CATG 5 cut(s) 10, 322, 407, 494, 524
FaqI GGGAC 2 cut(s) 310, 564
FatI CATG 5 cut(s) 6, 318, 403, 490, 520
FbaI TGATCA 1 cut(s) 421
FblI GTMKAC 2 cut(s) 219, 618
Fnu4HI GCNGC 5 cut(s) 69, 152, 338, 388, 606
FokI GGATG 1 cut(s) 343
Fsp4HI GCNGC 5 cut(s) 69, 152, 338, 388, 606
FspBI CTAG 1 cut(s) 327
GluI GCNGC 5 cut(s) 69, 152, 338, 388, 606
GsaI CCCAGC 1 cut(s) 549
GsuI CTGGAG 1 cut(s) 448
HaeIII GGCC 4 cut(s) 5, 45, 71, 189
HgaI GACGC 1 cut(s) 82
Hin1I GRCGYC 1 cut(s) 93
Hin1II CATG 5 cut(s) 10, 322, 407, 494, 524
HincII GTYRAC 2 cut(s) 220, 496
HindII GTYRAC 2 cut(s) 220, 496
HinfI GANTC 1 cut(s) 407
HphI GGTGA 2 cut(s) 290, 431
Hpy166II GTNNAC 3 cut(s) 220, 496, 619
Hpy188I TCNGA 3 cut(s) 88, 291, 412
Hpy188III TCNNGA 2 cut(s) 97, 521
Hpy8I GTNNAC 3 cut(s) 220, 496, 619
Hpy99I CGWCG 3 cut(s) 98, 167, 224
HpyAV CCTTC 3 cut(s) 437, 605, 632
HpyCH4III ACNGT 2 cut(s) 115, 518
HpyCH4IV ACGT 2 cut(s) 165, 583
HpyCH4V TGCA 5 cut(s) 130, 154, 313, 340, 352
HpyF10VI GCNNNNNNNGC 3 cut(s) 18, 157, 166
HpyF3I CTNAG 4 cut(s) 22, 85, 252, 639
HpySE526I ACGT 2 cut(s) 165, 583
Hsp92I GRCGYC 1 cut(s) 93
Hsp92II CATG 5 cut(s) 10, 322, 407, 494, 524
Ksp22I TGATCA 1 cut(s) 421
Kzo9I GATC 4 cut(s) 99, 300, 421, 469
Lsp1109I GCAGC 4 cut(s) 138, 324, 374, 617
LweI GCATC 3 cut(s) 117, 214, 365
MaeI CTAG 1 cut(s) 327
MaeII ACGT 2 cut(s) 165, 583
MaeIII GTNAC 3 cut(s) 199, 278, 628
MalI GATC 4 cut(s) 101, 302, 423, 471
MboI GATC 4 cut(s) 99, 300, 421, 469
MboII GAAGA 3 cut(s) 22, 28, 466
MhlI GDGCHC 1 cut(s) 120
MlsI TGGCCA 2 cut(s) 5, 189
MluCI AATT 1 cut(s) 483
MluNI TGGCCA 2 cut(s) 5, 189
MmeI TCCRAC 1 cut(s) 226
Mox20I TGGCCA 2 cut(s) 5, 189
MscI TGGCCA 2 cut(s) 5, 189
MslI CAYNNNNRTG 1 cut(s) 519
Msp20I TGGCCA 2 cut(s) 5, 189
MspR9I CCNGG 2 cut(s) 271, 460
Mva1269I GAATGC 1 cut(s) 285
MvaI CCWGG 2 cut(s) 271, 460
MvnI CGCG 1 cut(s) 68
MwoI GCNNNNNNNGC 3 cut(s) 18, 157, 166
NcoI CCATGG 1 cut(s) 6
NdeII GATC 4 cut(s) 99, 300, 421, 469
NlaIII CATG 5 cut(s) 10, 322, 407, 494, 524
NmeAIII GCCGAG 1 cut(s) 21
NmuCI GTSAC 2 cut(s) 199, 278
NspI RCATGY 1 cut(s) 494
NspV TTCGAA 1 cut(s) 481
PagI TCATGA 1 cut(s) 520
PctI GAATGC 1 cut(s) 285
PfeI GAWTC 1 cut(s) 407
PkrI GCNGC 5 cut(s) 70, 153, 339, 389, 607
Ple19I CGATCG 1 cut(s) 303
PshAI GACNNNNGTC 1 cut(s) 302
Psp6I CCWGG 2 cut(s) 269, 458
PspFI CCCAGC 1 cut(s) 545
PspGI CCWGG 2 cut(s) 269, 458
PspPI GGNCC 2 cut(s) 138, 248
PstNI CAGNNNCTG 1 cut(s) 632
PvuI CGATCG 1 cut(s) 303
RseI CAYNNNNRTG 1 cut(s) 519
SalI GTCGAC 1 cut(s) 218
SatI GCNGC 5 cut(s) 69, 152, 338, 388, 606
Sau3AI GATC 4 cut(s) 99, 300, 421, 469
Sau96I GGNCC 2 cut(s) 138, 248
ScrFI CCNGG 2 cut(s) 271, 460
SduI GDGCHC 1 cut(s) 120
SfaNI GCATC 3 cut(s) 117, 214, 365
SfuI TTCGAA 1 cut(s) 481
SinI GGWCC 2 cut(s) 138, 248
SmiMI CAYNNNNRTG 1 cut(s) 519
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 1 cut(s) 483
SsiI CCGC 1 cut(s) 68
SspMI CTAG 1 cut(s) 327
StyD4I CCNGG 2 cut(s) 269, 458
StyI CCWWGG 1 cut(s) 6
TaaI ACNGT 2 cut(s) 115, 518
TaiI ACGT 2 cut(s) 168, 586
TaqI TCGA 5 cut(s) 48, 54, 96, 219, 481
TasI AATT 1 cut(s) 483
TauI GCSGC 1 cut(s) 71
TfiI GAWTC 1 cut(s) 407
TscAI CASTG 4 cut(s) 190, 208, 431, 505
TseFI GTSAC 2 cut(s) 199, 278
TseI GCWGC 4 cut(s) 151, 337, 387, 605
Tsp45I GTSAC 2 cut(s) 199, 278
TspDTI ATGAA 1 cut(s) 420
TspGWI ACGGA 2 cut(s) 123, 187
TspRI CASTG 4 cut(s) 190, 208, 431, 505
VpaK11BI GGWCC 2 cut(s) 138, 248
XapI RAATTY 1 cut(s) 483
XceI RCATGY 1 cut(s) 494
XcmI CCANNNNNNNNNTGG 1 cut(s) 542
XmiI GTMKAC 2 cut(s) 219, 618
XspI CTAG 1 cut(s) 327
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.