Rmu_sc0039838.1_g000001

L-ascorbate oxidase homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039838.1
Physical Location & Seq
Forward (+)
1 .. 646
646 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039838.1_g000001.1.cds

Sequence Viewer

Length: 203 bp
ttcatggcgctaatggtgaagacccatataagttaatcacctggaaaatcacttacggcgacatttatcctctgggtgttaagcaacaggggatcttgatcaatgaccaatttccagggcctcaaattgatgctgtgacaaatatgaacttggttatcagtgtgttcaattacttgagtgaaccatttcttatttcttggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.45

Weight (kDa)

4.52

Isoelectric Point (pI)

19.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 100
AgsI TTSAA 1 cut(s) 168
AjnI CCWGG 2 cut(s) 40, 114
AlwI GGATC 1 cut(s) 100
AoxI GGCC 1 cut(s) 118
Asp700I GAANNNNTTC 1 cut(s) 185
AspLEI GCGC 1 cut(s) 10
AspS9I GGNCC 1 cut(s) 118
AsuHPI GGTGA 2 cut(s) 28, 30
BbsI GAAGAC 1 cut(s) 26
BceAI ACGGC 1 cut(s) 72
BciT130I CCWGG 2 cut(s) 42, 116
BclI TGATCA 1 cut(s) 98
BfoI RGCGCY 1 cut(s) 11
Bme1390I CCNGG 2 cut(s) 42, 116
BmgT120I GGNCC 1 cut(s) 118
BmrFI CCNGG 2 cut(s) 42, 116
BmsI GCATC 1 cut(s) 120
BpiI GAAGAC 1 cut(s) 26
BpuEI CTTGAG 1 cut(s) 195
BsaBI GATNNNNATC 1 cut(s) 97
BsaJI CCNNGG 1 cut(s) 115
Bse8I GATNNNNATC 1 cut(s) 97
BseBI CCWGG 2 cut(s) 42, 116
BseDI CCNNGG 1 cut(s) 115
BseJI GATNNNNATC 1 cut(s) 97
BshFI GGCC 1 cut(s) 120
BsnI GGCC 1 cut(s) 120
Bsp143I GATC 2 cut(s) 92, 98
BspANI GGCC 1 cut(s) 120
BspPI GGATC 1 cut(s) 100
BssECI CCNNGG 1 cut(s) 115
BssMI GATC 2 cut(s) 92, 98
Bst2UI CCWGG 2 cut(s) 42, 116
BstH2I RGCGCY 1 cut(s) 11
BstHHI GCGC 1 cut(s) 10
BstKTI GATC 2 cut(s) 95, 101
BstMBI GATC 2 cut(s) 92, 98
BstNI CCWGG 2 cut(s) 42, 116
BstSCI CCNGG 2 cut(s) 40, 114
BstV2I GAAGAC 1 cut(s) 26
BstX2I RGATCY 1 cut(s) 92
BstYI RGATCY 1 cut(s) 92
BsuRI GGCC 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 165
CfoI GCGC 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 118
CviAII CATG 1 cut(s) 4
CviJI RGCY 1 cut(s) 120
CviKI_1 RGCY 1 cut(s) 120
DpnI GATC 2 cut(s) 94, 100
DpnII GATC 2 cut(s) 92, 98
EcoO109I RGGNCCY 1 cut(s) 118
EcoRII CCWGG 2 cut(s) 40, 114
FaeI CATG 1 cut(s) 7
FaiI YATR 4 cut(s) 5, 27, 29, 145
FatI CATG 1 cut(s) 3
FbaI TGATCA 1 cut(s) 98
GlaI GCGC 1 cut(s) 9
HaeII RGCGCY 1 cut(s) 11
HaeIII GGCC 1 cut(s) 120
HhaI GCGC 1 cut(s) 10
Hin1II CATG 1 cut(s) 7
Hin6I GCGC 1 cut(s) 8
HinP1I GCGC 1 cut(s) 8
HphI GGTGA 2 cut(s) 28, 30
Hpy166II GTNNAC 1 cut(s) 181
Hpy188III TCNNGA 1 cut(s) 96
Hpy8I GTNNAC 1 cut(s) 181
Hsp92II CATG 1 cut(s) 7
HspAI GCGC 1 cut(s) 8
Ksp22I TGATCA 1 cut(s) 98
Kzo9I GATC 2 cut(s) 92, 98
LpnPI CCDG 6 cut(s) 27, 54, 58, 73, 101, 128
LweI GCATC 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 135
MalI GATC 2 cut(s) 94, 100
MboI GATC 2 cut(s) 92, 98
MboII GAAGA 1 cut(s) 31
MflI RGATCY 1 cut(s) 92
MluCI AATT 3 cut(s) 109, 125, 168
MnlI CCTC 2 cut(s) 80, 131
MroXI GAANNNNTTC 1 cut(s) 185
MseI TTAA 2 cut(s) 34, 80
MspR9I CCNGG 2 cut(s) 42, 116
MvaI CCWGG 2 cut(s) 42, 116
NdeII GATC 2 cut(s) 92, 98
NlaIII CATG 1 cut(s) 7
NmuCI GTSAC 1 cut(s) 135
PdmI GAANNNNTTC 1 cut(s) 185
Psp6I CCWGG 2 cut(s) 40, 114
PspGI CCWGG 2 cut(s) 40, 114
PspPI GGNCC 1 cut(s) 118
PsuI RGATCY 1 cut(s) 92
SaqAI TTAA 2 cut(s) 34, 80
Sau3AI GATC 2 cut(s) 92, 98
Sau96I GGNCC 1 cut(s) 118
ScrFI CCNGG 2 cut(s) 42, 116
SetI ASST 1 cut(s) 43
SfaNI GCATC 1 cut(s) 120
SmlI CTYRAG 1 cut(s) 174
SmoI CTYRAG 1 cut(s) 174
Sse9I AATT 3 cut(s) 109, 125, 168
StyD4I CCNGG 2 cut(s) 40, 114
TasI AATT 3 cut(s) 109, 125, 168
Tru1I TTAA 2 cut(s) 34, 80
Tru9I TTAA 2 cut(s) 34, 80
TscAI CASTG 1 cut(s) 165
TseFI GTSAC 1 cut(s) 135
Tsp45I GTSAC 1 cut(s) 135
TspDTI ATGAA 1 cut(s) 160
TspRI CASTG 1 cut(s) 165
XmnI GAANNNNTTC 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.