Rmu_sc0040593.1_g000001
NAC Family

Inactive leucine-rich repeat receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040593.1
OG0012108
Physical Location & Seq
Forward (+)
1085 .. 2503
1419 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040593.1_g000001.1.cds

Sequence Viewer

Length: 1419 bp
atggagcagcaatactactactcaaggtactctaatttcttattcttctctgtgattttacttctccccttggttcaagccggcgacgccgaagctctgttaagcctgaaatcgacactggatccgacgaactcgctgccgtggcggcaaggaagcaatgtgtgtgagtgggaaggtgttagagactgtatgaaaggaagagtcacgaagttggtgttggagtacttaaatttgaccggcactctcgaccagaaaatcctgaaccagctggatcagctccgagttctgagcttcaagggcaactcaatttccggccaaatccccgacctctccggcctcgtcaatctcaagtccctcttcttgaacgacaacaatttctccggcgttttccccgcgtccgtttcgtccctccaccgcttgaaagtcctcgtcctcgccggcaaccacatctccggcgacattccggcgtcgctgctcaatctccgccgtctatatgttctgtatttacaagacaatcagttcagcggcgccattccgccgctcaatcaaacctccctccggtttttcaatgtctctaacaaccaactctccggcgaaatccctatcacggcggcgctcattcggttcaacgcctcgtcgtttttcggaaacatcaatgtctgcggtctgcagactcacaacaaatgccagaacggcattgctttcccgccgctactcgggccgagttcttatgatggtaaacctacaaagccgaaatccaatcgttccaagctcataaagatcatagcagcaagtgtaggaggttttgtgctgcttgttataagtttgcttctattgttcctattgtgccggaaacacagccgtcgcaaagatgccgagatcagaaacaaaggggctgttcacggcgttgaggggacggagaccggaggaggaggaggaggaggaggtggaggtggggagggtccttcaggcggtggtaggggaggtaataacggtggaaagcaaggggcgttttcgtgggagggtgatggactggggagcctggtgttctgcggtccaggggatcagcaaatgaattacagtctggaggatttactgaaggcttcggctgagacactggggaggggtagtatgggaagtacgtataaagctgtgatggagtctgggtttattgtgacagtgaagaggctcaaggatgcgaggtaccctaggcttgatgagtttaggagacacatggacttgcttgggaagctgaggcaccctcacttggtgcctctcagggcctattttcaggctaaggaggaacggttgctcgtatacgattacttccctaatggcagcctcttctcgctcattcatggtacgttgttcattcttcatctacttttttacctgccggttaaattttttcgtctttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_8 Pkinase

Protein Analysis

472

Amino Acids

51.71

Weight (kDa)

9.5

Isoelectric Point (pI)

32.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012108)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G10850
fragaria_vesca FvH4_4g36460
malus_domestica MD13G1009100.v1.1 MD16G1007100.v1.1
prunus_persica Prupe.1G343600_v2.0.a1
pyrus_communis pycom13g00770 pycom16g00670
rosa_chinensis RchiOBHm_Chr4g0446221
rosa_laevigata RLG00000005680
rosa_multiflora Rmu_co8398623.1_g000001 Rmu_sc0002266.1_g000012 Rmu_sc0040593.1_g000001
rosa_roxburghii Rroxscaffold_5G00386620
rosa_rugosa Rorug04G0368500
rosa_samantha Rh4AG430700 Rh4BG440100 Rh4CG457400 Rh4DG438600
rosa_wichuraiana Rw4G036790

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 821
Acc36I ACCTGC 1 cut(s) 1401
Acc65I GGTACC 1 cut(s) 1203
AccB1I GGYRCC 4 cut(s) 527, 1203, 1257, 1270
AccBSI CCGCTC 1 cut(s) 541
AccI GTMKAC 1 cut(s) 1317
AccII CGCG 1 cut(s) 395
AclWI GGATC 4 cut(s) 116, 129, 279, 1071
AcoI YGGCCR 1 cut(s) 313
AcsI RAATTY 2 cut(s) 229, 1403
AcuI CTGAAG 2 cut(s) 951, 1118
AcyI GRCGYC 3 cut(s) 87, 467, 528
AdeI CACNNNGTG 1 cut(s) 1270
AfaI GTAC 5 cut(s) 29, 224, 1141, 1205, 1363
AfiI CCNNNNNNNGG 5 cut(s) 558, 607, 716, 971, 1267
AgsI TTSAA 6 cut(s) 77, 295, 364, 421, 568, 628
AjnI CCWGG 2 cut(s) 1041, 1057
AjuI GAANNNNNNNTTGG 2 cut(s) 200, 232
AluBI AGCT 7 cut(s) 95, 268, 277, 291, 772, 1151, 1252
AluI AGCT 7 cut(s) 95, 268, 277, 291, 772, 1151, 1252
Alw26I GTCTC 5 cut(s) 177, 577, 914, 1106, 1222
AlwI GGATC 4 cut(s) 116, 129, 279, 1071
Ama87I CYCGRG 1 cut(s) 716
AoxI GGCC 4 cut(s) 313, 334, 719, 1281
ApeKI GCWGC 6 cut(s) 7, 136, 472, 788, 811, 1338
ApoI RAATTY 2 cut(s) 229, 1403
Asp718I GGTACC 1 cut(s) 1203
AspA2I CCTAGG 1 cut(s) 1208
AspLEI GCGC 2 cut(s) 530, 616
AspS9I GGNCC 4 cut(s) 719, 962, 1055, 1281
AsuHPI GGTGA 1 cut(s) 1037
AvaI CYCGRG 1 cut(s) 716
AvaII GGWCC 2 cut(s) 962, 1055
AvrII CCTAGG 1 cut(s) 1208
BamHI GGATCC 1 cut(s) 121
BanI GGYRCC 4 cut(s) 527, 1203, 1257, 1270
BbvCI CCTCAGC 1 cut(s) 1253
BbvI GCAGC 6 cut(s) 19, 123, 459, 798, 800, 1350
BccI CCATC 3 cut(s) 728, 1022, 1150
BceAI ACGGC 6 cut(s) 124, 471, 624, 709, 846, 919
BcgI CGANNNNNNTGC 2 cut(s) 118, 152
BciT130I CCWGG 2 cut(s) 1043, 1059
BcoDI GTCTC 5 cut(s) 177, 577, 914, 1106, 1222
BfaI CTAG 1 cut(s) 1209
BfmI CTRYAG 1 cut(s) 668
BfoI RGCGCY 2 cut(s) 531, 617
BfuAI ACCTGC 1 cut(s) 1401
BglI GCCNNNNNGGC 2 cut(s) 145, 693
BlnI CCTAGG 1 cut(s) 1208
BmcAI AGTACT 1 cut(s) 224
Bme1390I CCNGG 2 cut(s) 1043, 1059
Bme18I GGWCC 2 cut(s) 962, 1055
BmeT110I CYCGRG 1 cut(s) 716
BmgT120I GGNCC 4 cut(s) 719, 962, 1055, 1281
BmiI GGNNCC 7 cut(s) 123, 529, 963, 1040, 1205, 1259, 1272
BmrFI CCNGG 2 cut(s) 1043, 1059
BmrI ACTGGG 2 cut(s) 1043, 1127
BmsI GCATC 2 cut(s) 862, 1186
BmuI ACTGGG 2 cut(s) 1043, 1127
BplI GAGNNNNNCTC 2 cut(s) 1246, 1278
BpmI CTGGAG 1 cut(s) 1106
Bpu10I CCTNAGC 2 cut(s) 1253, 1296
BpuEI CTTGAG 3 cut(s) 7, 332, 1175
BsaAI YACGTR 1 cut(s) 1143
BsaHI GRCGYC 3 cut(s) 87, 467, 528
BsaI GGTCTC 1 cut(s) 914
BsaJI CCNNGG 4 cut(s) 69, 140, 1058, 1208
BsaWI WCCGGW 2 cut(s) 558, 923
Bsc4I CCNNNNNNNGG 5 cut(s) 558, 607, 716, 971, 1267
Bse118I RCCGGY 4 cut(s) 80, 236, 437, 1396
Bse1I ACTGG 3 cut(s) 123, 1038, 1122
Bse3DI GCAATG 2 cut(s) 163, 696
BseBI CCWGG 2 cut(s) 1043, 1059
BseDI CCNNGG 4 cut(s) 69, 140, 1058, 1208
BseGI GGATG 1 cut(s) 1201
BseLI CCNNNNNNNGG 5 cut(s) 558, 607, 716, 971, 1267
BseMI GCAATG 2 cut(s) 163, 696
BseMII CTCAG 4 cut(s) 278, 1101, 1244, 1291
BseNI ACTGG 3 cut(s) 123, 1038, 1122
BseRI GAGGAG 6 cut(s) 942, 945, 948, 951, 954, 957
BseXI GCAGC 6 cut(s) 19, 123, 459, 798, 800, 1350
Bsh1236I CGCG 1 cut(s) 395
BshFI GGCC 4 cut(s) 315, 336, 721, 1283
BshNI GGYRCC 4 cut(s) 527, 1203, 1257, 1270
BsiHKCI CYCGRG 1 cut(s) 716
BslFI GGGAC 3 cut(s) 337, 391, 928
BslI CCNNNNNNNGG 5 cut(s) 558, 607, 716, 971, 1267
BsmAI GTCTC 5 cut(s) 177, 577, 914, 1106, 1222
BsmFI GGGAC 3 cut(s) 337, 391, 928
BsnI GGCC 4 cut(s) 315, 336, 721, 1283
Bso31I GGTCTC 1 cut(s) 914
BsoBI CYCGRG 1 cut(s) 716
Bsp143I GATC 5 cut(s) 121, 271, 780, 879, 1063
BspANI GGCC 4 cut(s) 315, 336, 721, 1283
BspCNI CTCAG 4 cut(s) 279, 1102, 1245, 1290
BspFNI CGCG 1 cut(s) 395
BspLI GGNNCC 7 cut(s) 123, 529, 963, 1040, 1205, 1259, 1272
BspMAI CTGCAG 1 cut(s) 672
BspMI ACCTGC 1 cut(s) 1401
BspPI GGATC 4 cut(s) 116, 129, 279, 1071
BspT107I GGYRCC 4 cut(s) 527, 1203, 1257, 1270
BspTNI GGTCTC 1 cut(s) 914
BsrBI CCGCTC 1 cut(s) 541
BsrDI GCAATG 2 cut(s) 163, 696
BsrFI RCCGGY 4 cut(s) 80, 236, 437, 1396
BsrI ACTGG 3 cut(s) 123, 1038, 1122
BssAI RCCGGY 4 cut(s) 80, 236, 437, 1396
BssECI CCNNGG 4 cut(s) 69, 140, 1058, 1208
BssMI GATC 5 cut(s) 121, 271, 780, 879, 1063
BssNAI GTATAC 1 cut(s) 1318
BssNI GRCGYC 3 cut(s) 87, 467, 528
BssT1I CCWWGG 2 cut(s) 69, 1208
Bst1107I GTATAC 1 cut(s) 1318
Bst2UI CCWGG 2 cut(s) 1043, 1059
Bst4CI ACNGT 5 cut(s) 188, 995, 1082, 1180, 1308
Bst6I CTCTTC 4 cut(s) 193, 362, 1178, 1349
BstACI GRCGYC 3 cut(s) 87, 467, 528
BstBAI YACGTR 1 cut(s) 1143
BstC8I GCNNGC 2 cut(s) 82, 439
BstDEI CTNAG 5 cut(s) 287, 1110, 1253, 1277, 1296
BstDSI CCRYGG 1 cut(s) 140
BstF5I GGATG 1 cut(s) 1201
BstFNI CGCG 1 cut(s) 395
BstH2I RGCGCY 2 cut(s) 531, 617
BstHHI GCGC 2 cut(s) 530, 616
BstKTI GATC 5 cut(s) 124, 274, 783, 882, 1066
BstMAI GTCTC 5 cut(s) 177, 577, 914, 1106, 1222
BstMBI GATC 5 cut(s) 121, 271, 780, 879, 1063
BstMWI GCNNNNNNNGC 8 cut(s) 86, 142, 145, 274, 297, 693, 718, 1249
BstNI CCWGG 2 cut(s) 1043, 1059
BstSCI CCNGG 2 cut(s) 1041, 1057
BstSFI CTRYAG 1 cut(s) 668
BstSNI TACGTA 1 cut(s) 1143
BstUI CGCG 1 cut(s) 395
BstV1I GCAGC 6 cut(s) 19, 123, 459, 798, 800, 1350
BstX2I RGATCY 1 cut(s) 121
BstYI RGATCY 1 cut(s) 121
BstZ17I GTATAC 1 cut(s) 1318
BsuRI GGCC 4 cut(s) 315, 336, 721, 1283
BtgI CCRYGG 1 cut(s) 140
BtsCI GGATG 1 cut(s) 1201
BtsIMutI CAGTG 3 cut(s) 116, 1115, 1185
BveI ACCTGC 1 cut(s) 1401
Cac8I GCNNGC 2 cut(s) 82, 439
CfoI GCGC 2 cut(s) 530, 616
Cfr10I RCCGGY 4 cut(s) 80, 236, 437, 1396
Cfr13I GGNCC 4 cut(s) 719, 962, 1055, 1281
CseI GACGC 3 cut(s) 95, 384, 456
Csp6I GTAC 5 cut(s) 28, 223, 1140, 1204, 1362
CviAII CATG 2 cut(s) 1234, 1358
CviQI GTAC 5 cut(s) 28, 223, 1140, 1204, 1362
DdeI CTNAG 5 cut(s) 287, 1110, 1253, 1277, 1296
DinI GGCGCC 1 cut(s) 529
DpnI GATC 5 cut(s) 123, 273, 782, 881, 1065
DpnII GATC 5 cut(s) 121, 271, 780, 879, 1063
DraIII CACNNNGTG 1 cut(s) 1270
EaeI YGGCCR 1 cut(s) 313
Eam1104I CTCTTC 4 cut(s) 193, 362, 1178, 1349
EarI CTCTTC 4 cut(s) 193, 362, 1178, 1349
EciI GGCGGA 2 cut(s) 473, 525
Eco105I TACGTA 1 cut(s) 1143
Eco130I CCWWGG 2 cut(s) 69, 1208
Eco31I GGTCTC 1 cut(s) 914
Eco47I GGWCC 2 cut(s) 962, 1055
Eco57I CTGAAG 2 cut(s) 951, 1118
Eco88I CYCGRG 1 cut(s) 716
EcoO109I RGGNCCY 2 cut(s) 962, 1281
EcoRII CCWGG 2 cut(s) 1041, 1057
EcoT14I CCWWGG 2 cut(s) 69, 1208
EgeI GGCGCC 1 cut(s) 529
EheI GGCGCC 1 cut(s) 529
ErhI CCWWGG 2 cut(s) 69, 1208
FaeI CATG 2 cut(s) 1237, 1361
FalI AAGNNNNNCTT 2 cut(s) 341, 373
FaqI GGGAC 3 cut(s) 337, 391, 928
FatI CATG 2 cut(s) 1233, 1357
FauI CCCGC 2 cut(s) 400, 714
FblI GTMKAC 1 cut(s) 1317
FokI GGATG 1 cut(s) 1208
FspBI CTAG 1 cut(s) 1209
GlaI GCGC 2 cut(s) 529, 615
GsuI CTGGAG 1 cut(s) 1106
HaeII RGCGCY 2 cut(s) 531, 617
HaeIII GGCC 4 cut(s) 315, 336, 721, 1283
HgaI GACGC 3 cut(s) 95, 384, 456
HhaI GCGC 2 cut(s) 530, 616
Hin1I GRCGYC 3 cut(s) 87, 467, 528
Hin1II CATG 2 cut(s) 1237, 1361
Hin6I GCGC 2 cut(s) 528, 614
HinP1I GCGC 2 cut(s) 528, 614
HinfI GANTC 3 cut(s) 201, 673, 1160
HphI GGTGA 1 cut(s) 1037
Hpy166II GTNNAC 3 cut(s) 740, 901, 1318
Hpy188I TCNGA 5 cut(s) 126, 281, 288, 647, 884
Hpy188III TCNNGA 5 cut(s) 205, 245, 259, 361, 1085
Hpy8I GTNNAC 3 cut(s) 740, 901, 1318
Hpy99I CGWCG 5 cut(s) 89, 130, 472, 640, 867
HpyAV CCTTC 3 cut(s) 167, 975, 1093
HpyCH4III ACNGT 5 cut(s) 188, 995, 1082, 1180, 1308
HpyCH4IV ACGT 2 cut(s) 1142, 1364
HpyCH4V TGCA 1 cut(s) 670
HpyF10VI GCNNNNNNNGC 8 cut(s) 86, 142, 145, 274, 297, 693, 718, 1249
HpyF3I CTNAG 5 cut(s) 287, 1110, 1253, 1277, 1296
HpySE526I ACGT 2 cut(s) 1142, 1364
Hsp92I GRCGYC 3 cut(s) 87, 467, 528
Hsp92II CATG 2 cut(s) 1237, 1361
HspAI GCGC 2 cut(s) 528, 614
KasI GGCGCC 1 cut(s) 527
KpnI GGTACC 1 cut(s) 1207
KroI GCCGGC 2 cut(s) 80, 437
KroNI GCCGGC 2 cut(s) 82, 439
Kzo9I GATC 5 cut(s) 121, 271, 780, 879, 1063
LmnI GCTCC 3 cut(s) 4, 282, 1038
Lsp1109I GCAGC 6 cut(s) 19, 123, 459, 798, 800, 1350
LweI GCATC 2 cut(s) 862, 1186
MaeI CTAG 1 cut(s) 1209
MaeII ACGT 2 cut(s) 1142, 1364
MaeIII GTNAC 2 cut(s) 202, 1174
MalI GATC 5 cut(s) 123, 273, 782, 881, 1065
MbiI CCGCTC 1 cut(s) 541
MboI GATC 5 cut(s) 121, 271, 780, 879, 1063
MboII GAAGA 6 cut(s) 37, 210, 349, 1195, 1336, 1367
MflI RGATCY 1 cut(s) 121
MluCI AATT 6 cut(s) 34, 229, 306, 373, 1075, 1403
Mly113I GGCGCC 1 cut(s) 528
MlyI GAGTC 3 cut(s) 210, 667, 1169
MmeI TCCRAC 2 cut(s) 149, 198
MroNI GCCGGC 2 cut(s) 80, 437
MseI TTAA 3 cut(s) 101, 227, 1401
MspA1I CMGCKG 2 cut(s) 268, 525
MspR9I CCNGG 2 cut(s) 1043, 1059
MvaI CCWGG 2 cut(s) 1043, 1059
MvnI CGCG 1 cut(s) 395
MwoI GCNNNNNNNGC 8 cut(s) 86, 142, 145, 274, 297, 693, 718, 1249
NaeI GCCGGC 2 cut(s) 82, 439
NarI GGCGCC 1 cut(s) 528
NdeII GATC 5 cut(s) 121, 271, 780, 879, 1063
NgoMIV GCCGGC 2 cut(s) 80, 437
NlaIII CATG 2 cut(s) 1237, 1361
NlaIV GGNNCC 7 cut(s) 123, 529, 963, 1040, 1205, 1259, 1272
NmeAIII GCCGAG 2 cut(s) 747, 901
NmuCI GTSAC 2 cut(s) 202, 1174
PdiI GCCGGC 2 cut(s) 82, 439
PleI GAGTC 3 cut(s) 209, 667, 1168
PluTI GGCGCC 1 cut(s) 531
PpsI GAGTC 3 cut(s) 209, 667, 1168
Ppu21I YACGTR 1 cut(s) 1143
PpuMI RGGWCCY 1 cut(s) 962
PsiI TTATAA 1 cut(s) 821
Psp5II RGGWCCY 1 cut(s) 962
Psp6I CCWGG 2 cut(s) 1041, 1057
PspGI CCWGG 2 cut(s) 1041, 1057
PspN4I GGNNCC 7 cut(s) 123, 529, 963, 1040, 1205, 1259, 1272
PspPI GGNCC 4 cut(s) 719, 962, 1055, 1281
PspPPI RGGWCCY 1 cut(s) 962
PstI CTGCAG 1 cut(s) 672
PsuI RGATCY 1 cut(s) 121
PvuII CAGCTG 1 cut(s) 268
RsaI GTAC 5 cut(s) 29, 224, 1141, 1205, 1363
RsaNI GTAC 5 cut(s) 28, 223, 1140, 1204, 1362
SaqAI TTAA 3 cut(s) 101, 227, 1401
Sau3AI GATC 5 cut(s) 121, 271, 780, 879, 1063
Sau96I GGNCC 4 cut(s) 719, 962, 1055, 1281
ScaI AGTACT 1 cut(s) 224
SchI GAGTC 3 cut(s) 210, 667, 1169
ScrFI CCNGG 2 cut(s) 1043, 1059
SfaNI GCATC 2 cut(s) 862, 1186
SfcI CTRYAG 1 cut(s) 668
SfoI GGCGCC 1 cut(s) 529
SinI GGWCC 2 cut(s) 962, 1055
SmlI CTYRAG 3 cut(s) 22, 347, 1190
SmoI CTYRAG 3 cut(s) 22, 347, 1190
SnaBI TACGTA 1 cut(s) 1143
Sse9I AATT 6 cut(s) 34, 229, 306, 373, 1075, 1403
SspDI GGCGCC 1 cut(s) 527
SspMI CTAG 1 cut(s) 1209
StyD4I CCNGG 2 cut(s) 1041, 1057
StyI CCWWGG 2 cut(s) 69, 1208
TaaI ACNGT 5 cut(s) 188, 995, 1082, 1180, 1308
TaiI ACGT 2 cut(s) 1145, 1367
TaqI TCGA 2 cut(s) 113, 246
TasI AATT 6 cut(s) 34, 229, 306, 373, 1075, 1403
TatI WGTACW 1 cut(s) 222
TauI GCSGC 5 cut(s) 148, 528, 541, 614, 712
Tru1I TTAA 3 cut(s) 101, 227, 1401
Tru9I TTAA 3 cut(s) 101, 227, 1401
TscAI CASTG 3 cut(s) 123, 1122, 1185
TseFI GTSAC 2 cut(s) 202, 1174
TseI GCWGC 6 cut(s) 7, 136, 472, 788, 811, 1338
Tsp45I GTSAC 2 cut(s) 202, 1174
TspDTI ATGAA 5 cut(s) 206, 1088, 1346, 1360, 1367
TspGWI ACGGA 2 cut(s) 388, 932
TspRI CASTG 3 cut(s) 123, 1122, 1185
VpaK11BI GGWCC 2 cut(s) 962, 1055
XapI RAATTY 2 cut(s) 229, 1403
XmaJI CCTAGG 1 cut(s) 1208
XmiI GTMKAC 1 cut(s) 1317
XspI CTAG 1 cut(s) 1209
ZrmI AGTACT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.