Rmu_sc0040692.1_g000001

Catalyzes the aldol cleavage of 4-hydroxy-4-methyl-2- oxoglutarate (HMG) into 2 molecules of pyruvate. Also contains a secondary oxaloacetate (OAA) decarboxylase activity due to the common pyruvate enolate transition state formed following C-C bond cleavage in the retro-aldol and decarboxylation reactions

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040692.1
Physical Location & Seq
Reverse (-)
582 .. 1082
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040692.1_g000001.1.cds

Sequence Viewer

Length: 501 bp
atggccttggttacaactgctgaagtctgcgatgcacattcgtcgctcattgtaagtggtgagcttcgggtgcttgagccgatctttcagatatatgggcggcggcaggtcttctctggacaagtagttaccttaaaggtattcgaagacaatgttctggttcgtgcgtttcttgaggagaaaggcaatggcagagttcttgttgtggacgggggtggaagcaagcggtgtgcaatattgggtggcaaccctgtagttcaagcccagaataatggctgggctggtatagtggtcaatggctgcataagagatgctgatgagattaatggctgtgacattggggtgagagctctggcttcccatccaatgaaggccaataagaagggaaccggagagaagcaagtaccgataaccattgctgggacaaggatcaacgatggggaatggctttatgcagacaccgatggaattctgatttctcataccgagctatctgtgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

166

Amino Acids

17.7

Weight (kDa)

5.6

Isoelectric Point (pI)

20.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 97
AciI CCGC 3 cut(s) 100, 103, 226
AclWI GGATC 1 cut(s) 437
AcsI RAATTY 1 cut(s) 468
AcuI CTGAAG 1 cut(s) 42
AfaI GTAC 1 cut(s) 405
AfiI CCNNNNNNNGG 1 cut(s) 420
AgsI TTSAA 1 cut(s) 260
AluBI AGCT 3 cut(s) 64, 350, 490
AluI AGCT 3 cut(s) 64, 350, 490
Alw21I GWGCWC 1 cut(s) 352
AlwI GGATC 1 cut(s) 437
AoxI GGCC 2 cut(s) 3, 372
ApeKI GCWGC 1 cut(s) 300
ApoI RAATTY 1 cut(s) 468
AseI ATTAAT 1 cut(s) 324
AsuHPI GGTGA 2 cut(s) 71, 355
AsuII TTCGAA 1 cut(s) 144
BanII GRGCYC 1 cut(s) 352
BbsI GAAGAC 2 cut(s) 103, 153
Bbv12I GWGCWC 1 cut(s) 352
BbvI GCAGC 1 cut(s) 287
BccI CCATC 3 cut(s) 369, 431, 458
BcgI CGANNNNNNTGC 2 cut(s) 24, 58
BfmI CTRYAG 1 cut(s) 252
BfuAI ACCTGC 1 cut(s) 97
BisI GCNGC 3 cut(s) 101, 104, 301
BlsI GCNGC 3 cut(s) 102, 105, 302
BmiI GGNNCC 1 cut(s) 388
BmsI GCATC 2 cut(s) 22, 301
BpiI GAAGAC 2 cut(s) 103, 153
Bpu14I TTCGAA 1 cut(s) 144
BpuEI CTTGAG 2 cut(s) 95, 194
BsaJI CCNNGG 1 cut(s) 6
BsaWI WCCGGW 1 cut(s) 389
Bsc4I CCNNNNNNNGG 1 cut(s) 420
Bse3DI GCAATG 2 cut(s) 193, 414
BseDI CCNNGG 1 cut(s) 6
BseGI GGATG 1 cut(s) 361
BseLI CCNNNNNNNGG 1 cut(s) 420
BseMI GCAATG 2 cut(s) 193, 414
BseRI GAGGAG 1 cut(s) 191
BseXI GCAGC 1 cut(s) 287
BseYI CCCAGC 2 cut(s) 276, 419
BshFI GGCC 2 cut(s) 5, 374
BsiHKAI GWGCWC 1 cut(s) 352
BsiSI CCGG 1 cut(s) 390
BslFI GGGAC 1 cut(s) 436
BslI CCNNNNNNNGG 1 cut(s) 420
BsmFI GGGAC 1 cut(s) 436
BsnI GGCC 2 cut(s) 5, 374
Bsp119I TTCGAA 1 cut(s) 144
Bsp1286I GDGCHC 1 cut(s) 352
Bsp143I GATC 2 cut(s) 81, 429
BspACI CCGC 3 cut(s) 100, 103, 226
BspANI GGCC 2 cut(s) 5, 374
BspLI GGNNCC 1 cut(s) 388
BspMI ACCTGC 1 cut(s) 97
BspPI GGATC 1 cut(s) 437
BspT104I TTCGAA 1 cut(s) 144
BsrDI GCAATG 2 cut(s) 193, 414
BssECI CCNNGG 1 cut(s) 6
BssMI GATC 2 cut(s) 81, 429
BssT1I CCWWGG 1 cut(s) 6
BstBI TTCGAA 1 cut(s) 144
BstC8I GCNNGC 1 cut(s) 224
BstF5I GGATG 1 cut(s) 361
BstKTI GATC 2 cut(s) 84, 432
BstMBI GATC 2 cut(s) 81, 429
BstMWI GCNNNNNNNGC 1 cut(s) 70
BstSFI CTRYAG 1 cut(s) 252
BstV1I GCAGC 1 cut(s) 287
BstV2I GAAGAC 2 cut(s) 103, 153
BstXI CCANNNNNNTGG 1 cut(s) 272
BsuRI GGCC 2 cut(s) 5, 374
BtgZI GCGATG 1 cut(s) 45
BtsCI GGATG 1 cut(s) 361
BveI ACCTGC 1 cut(s) 97
Cac8I GCNNGC 1 cut(s) 224
Csp6I GTAC 1 cut(s) 404
CviQI GTAC 1 cut(s) 404
DpnI GATC 2 cut(s) 83, 431
DpnII GATC 2 cut(s) 81, 429
Ecl136II GAGCTC 1 cut(s) 350
Eco130I CCWWGG 1 cut(s) 6
Eco24I GRGCYC 1 cut(s) 352
Eco53kI GAGCTC 1 cut(s) 350
Eco57I CTGAAG 1 cut(s) 42
EcoICRI GAGCTC 1 cut(s) 350
EcoRI GAATTC 1 cut(s) 468
EcoT14I CCWWGG 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 352
ErhI CCWWGG 1 cut(s) 6
FaiI YATR 6 cut(s) 94, 96, 287, 305, 453, 483
FaqI GGGAC 1 cut(s) 436
Fnu4HI GCNGC 3 cut(s) 101, 104, 301
FokI GGATG 1 cut(s) 348
FriOI GRGCYC 1 cut(s) 352
Fsp4HI GCNGC 3 cut(s) 101, 104, 301
GluI GCNGC 3 cut(s) 101, 104, 301
GsaI CCCAGC 2 cut(s) 280, 423
HaeIII GGCC 2 cut(s) 5, 374
HapII CCGG 1 cut(s) 390
HpaII CCGG 1 cut(s) 390
HphI GGTGA 2 cut(s) 71, 355
Hpy166II GTNNAC 1 cut(s) 208
Hpy188I TCNGA 2 cut(s) 90, 474
Hpy188III TCNNGA 2 cut(s) 117, 173
Hpy8I GTNNAC 1 cut(s) 208
Hpy99I CGWCG 1 cut(s) 46
HpyAV CCTTC 2 cut(s) 364, 376
HpyCH4V TGCA 4 cut(s) 35, 233, 303, 455
HpyF10VI GCNNNNNNNGC 1 cut(s) 70
Kzo9I GATC 2 cut(s) 81, 429
Lsp1109I GCAGC 1 cut(s) 287
LweI GCATC 2 cut(s) 22, 301
MaeIII GTNAC 3 cut(s) 10, 127, 332
MalI GATC 2 cut(s) 83, 431
MboI GATC 2 cut(s) 81, 429
MboII GAAGA 2 cut(s) 103, 158
MhlI GDGCHC 1 cut(s) 352
MluCI AATT 1 cut(s) 468
MnlI CCTC 1 cut(s) 169
MseI TTAA 2 cut(s) 134, 324
MslI CAYNNNNRTG 1 cut(s) 341
MspI CCGG 1 cut(s) 390
MwoI GCNNNNNNNGC 1 cut(s) 70
NdeII GATC 2 cut(s) 81, 429
NlaIV GGNNCC 1 cut(s) 388
NmuCI GTSAC 1 cut(s) 332
NspV TTCGAA 1 cut(s) 144
PkrI GCNGC 3 cut(s) 102, 105, 302
PshBI ATTAAT 1 cut(s) 324
Psp124BI GAGCTC 1 cut(s) 352
PspFI CCCAGC 2 cut(s) 276, 419
PspN4I GGNNCC 1 cut(s) 388
RsaI GTAC 1 cut(s) 405
RsaNI GTAC 1 cut(s) 404
RseI CAYNNNNRTG 1 cut(s) 341
SacI GAGCTC 1 cut(s) 352
SaqAI TTAA 2 cut(s) 134, 324
SatI GCNGC 3 cut(s) 101, 104, 301
Sau3AI GATC 2 cut(s) 81, 429
SduI GDGCHC 1 cut(s) 352
SetI ASST 6 cut(s) 66, 111, 134, 141, 352, 492
SfaNI GCATC 2 cut(s) 22, 301
SfcI CTRYAG 1 cut(s) 252
SfuI TTCGAA 1 cut(s) 144
SmiMI CAYNNNNRTG 1 cut(s) 341
SmlI CTYRAG 2 cut(s) 74, 173
SmoI CTYRAG 2 cut(s) 74, 173
Sse9I AATT 1 cut(s) 468
SsiI CCGC 3 cut(s) 100, 103, 226
SspI AATATT 1 cut(s) 237
SstI GAGCTC 1 cut(s) 352
StyI CCWWGG 1 cut(s) 6
TaqI TCGA 1 cut(s) 144
TasI AATT 1 cut(s) 468
TauI GCSGC 2 cut(s) 103, 106
Tru1I TTAA 2 cut(s) 134, 324
Tru9I TTAA 2 cut(s) 134, 324
TseFI GTSAC 1 cut(s) 332
TseI GCWGC 1 cut(s) 300
Tsp45I GTSAC 1 cut(s) 332
TspDTI ATGAA 1 cut(s) 383
VspI ATTAAT 1 cut(s) 324
XapI RAATTY 1 cut(s) 468
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.