Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041139.1

Orthogroup ID

OG0016777

Physical Location & Seq

Genomic Coordinates Forward (+)

987 .. 1757

Gene Structure 771 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041139.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 549 bp

atggctggattgaaggtggtgtttgttgttttggccatcagtttcagccttggagggaactgggtcggagctcaagtccaccatgtcgtcggaggagatcgtggctgggatcccgctaactccgatctcacttcttggtcctccggcaaaagctttatggtcggagacacactctggtttgcatattctgcagcacatgggttcatagcagaagtgaaaagcaaggaggaattcgaatcttgtgatgtgagcaatccgatcagaatgttcacagatggcttggatagcaccccaatggacaaggaaggactccgctacttcacaagcagcaaccctgagagctgcaagaatggcctcaagttacacgttcaagttgtgcctcatcaggatcgatctcaaactgtaatgccgatagtggcgacatccgagatctctgcattggctgcagctgaagggccaaccactccttctggttcagctcatctcagttctagtctcattttgttgtcatttgggtttgccttgctgtgttatggaatgggtcagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005886 GO:0009507 GO:0009536 GO:0016020 GO:0031224 GO:0031225 GO:0031226 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044425 GO:0044444 GO:0044459 GO:0044464 GO:0046658 GO:0048046 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cu_bind_like

Protein Analysis

182

Amino Acids

19.39

Weight (kDa)

5.39

Isoelectric Point (pI)

29.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016777)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g01050
malus_domestica	MD05G1357200.v1.1
prunus_persica	Prupe.4G011400_v2.0.a1
pyrus_communis	pycom10g28040
rosa_chinensis	RchiOBHm_Chr5g0001591
rosa_laevigata	RLG00000030945
rosa_multiflora	Rmu_sc0041139.1_g000001
rosa_roxburghii	Rroxscaffold_1G00074730
rosa_rugosa	Rorug04G0391200
rosa_samantha	Rh5AG012600 Rh5BG015500 Rh5CG013600 Rh5DG013400
rosa_wichuraiana	Rw5G001210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	114, 313
AclWI	GGATC	3 cut(s)	104, 117, 396
AcoI	YGGCCR	1 cut(s)	33
AcsI	RAATTY	1 cut(s)	230
AcuI	CTGAAG	1 cut(s)	471
AflIII	ACRYGT	1 cut(s)	364
AgsI	TTSAA	2 cut(s)	13, 371
AjuI	GAANNNNNNNTTGG	2 cut(s)	451, 483
AluBI	AGCT	5 cut(s)	71, 153, 342, 449, 479
AluI	AGCT	5 cut(s)	71, 153, 342, 449, 479
Alw21I	GWGCWC	1 cut(s)	73
Alw26I	GTCTC	2 cut(s)	159, 500
AlwI	GGATC	3 cut(s)	104, 117, 396
AoxI	GGCC	3 cut(s)	33, 352, 455
ApeKI	GCWGC	5 cut(s)	191, 327, 342, 443, 446
ApoI	RAATTY	1 cut(s)	230
AspS9I	GGNCC	2 cut(s)	138, 455
AsuII	TTCGAA	1 cut(s)	234
AvaII	GGWCC	1 cut(s)	138
BalI	TGGCCA	1 cut(s)	35
BamHI	GGATCC	1 cut(s)	109
BanII	GRGCYC	1 cut(s)	73
Bbv12I	GWGCWC	1 cut(s)	73
BbvI	GCAGC	5 cut(s)	203, 329, 339, 430, 458
BccI	CCATC	2 cut(s)	44, 269
BcgI	CGANNNNNNTGC	2 cut(s)	416, 450
BcoDI	GTCTC	2 cut(s)	159, 500
BfaI	CTAG	1 cut(s)	492
BfmI	CTRYAG	2 cut(s)	189, 444
BglII	AGATCT	1 cut(s)	429
BisI	GCNGC	5 cut(s)	192, 328, 343, 444, 447
BlsI	GCNGC	5 cut(s)	193, 329, 344, 445, 448
Bme18I	GGWCC	1 cut(s)	138
BmgT120I	GGNCC	2 cut(s)	138, 455
BmiI	GGNNCC	1 cut(s)	111
BmrI	ACTGGG	1 cut(s)	70
BmuI	ACTGGG	1 cut(s)	70
BplI	GAGNNNNNCTC	2 cut(s)	156, 188
Bpu14I	TTCGAA	1 cut(s)	234
BpuEI	CTTGAG	2 cut(s)	57, 341
Bsa29I	ATCGAT	1 cut(s)	391
BsaJI	CCNNGG	1 cut(s)	49
BsaXI	ACNNNNNCTCC	2 cut(s)	60, 90
Bse1I	ACTGG	1 cut(s)	65
BseCI	ATCGAT	1 cut(s)	391
BseDI	CCNNGG	1 cut(s)	49
BseGI	GGATG	1 cut(s)	422
BseMII	CTCAG	2 cut(s)	327, 499
BseNI	ACTGG	1 cut(s)	65
BseRI	GAGGAG	1 cut(s)	108
BseXI	GCAGC	5 cut(s)	203, 329, 339, 430, 458
BseYI	CCCAGC	1 cut(s)	105
BshFI	GGCC	3 cut(s)	35, 354, 457
BshVI	ATCGAT	1 cut(s)	391
BsiHKAI	GWGCWC	1 cut(s)	73
BsiSI	CCGG	1 cut(s)	144
BsmAI	GTCTC	2 cut(s)	159, 500
BsnI	GGCC	3 cut(s)	35, 354, 457
Bsp119I	TTCGAA	1 cut(s)	234
Bsp1286I	GDGCHC	1 cut(s)	73
Bsp143I	GATC	7 cut(s)	97, 109, 124, 258, 388, 392, 429
BspACI	CCGC	2 cut(s)	114, 313
BspANI	GGCC	3 cut(s)	35, 354, 457
BspCNI	CTCAG	2 cut(s)	328, 498
BspDI	ATCGAT	1 cut(s)	391
BspLI	GGNNCC	1 cut(s)	111
BspMAI	CTGCAG	2 cut(s)	193, 448
BspPI	GGATC	3 cut(s)	104, 117, 396
BspT104I	TTCGAA	1 cut(s)	234
BsrI	ACTGG	1 cut(s)	65
BssECI	CCNNGG	1 cut(s)	49
BssMI	GATC	7 cut(s)	97, 109, 124, 258, 388, 392, 429
BssT1I	CCWWGG	1 cut(s)	49
Bst4CI	ACNGT	1 cut(s)	403
BstAPI	GCANNNNNTGC	2 cut(s)	188, 443
BstBI	TTCGAA	1 cut(s)	234
BstDEI	CTNAG	2 cut(s)	336, 485
BstF5I	GGATG	1 cut(s)	422
BstKTI	GATC	7 cut(s)	100, 112, 127, 261, 391, 395, 432
BstMAI	GTCTC	2 cut(s)	159, 500
BstMBI	GATC	7 cut(s)	97, 109, 124, 258, 388, 392, 429
BstMWI	GCNNNNNNNGC	4 cut(s)	188, 285, 351, 443
BstSFI	CTRYAG	2 cut(s)	189, 444
BstV1I	GCAGC	5 cut(s)	203, 329, 339, 430, 458
BstX2I	RGATCY	2 cut(s)	109, 429
BstYI	RGATCY	2 cut(s)	109, 429
Bsu15I	ATCGAT	1 cut(s)	391
BsuRI	GGCC	3 cut(s)	35, 354, 457
BsuTUI	ATCGAT	1 cut(s)	391
BtsCI	GGATG	1 cut(s)	422
Cfr13I	GGNCC	2 cut(s)	138, 455
ClaI	ATCGAT	1 cut(s)	391
CviAII	CATG	2 cut(s)	83, 197
DdeI	CTNAG	2 cut(s)	336, 485
DpnI	GATC	7 cut(s)	99, 111, 126, 260, 390, 394, 431
DpnII	GATC	7 cut(s)	97, 109, 124, 258, 388, 392, 429
EaeI	YGGCCR	1 cut(s)	33
Ecl136II	GAGCTC	1 cut(s)	71
Eco130I	CCWWGG	1 cut(s)	49
Eco24I	GRGCYC	1 cut(s)	73
Eco47I	GGWCC	1 cut(s)	138
Eco53kI	GAGCTC	1 cut(s)	71
Eco57I	CTGAAG	1 cut(s)	471
EcoICRI	GAGCTC	1 cut(s)	71
EcoRI	GAATTC	1 cut(s)	230
EcoT14I	CCWWGG	1 cut(s)	49
EcoT38I	GRGCYC	1 cut(s)	73
ErhI	CCWWGG	1 cut(s)	49
FaeI	CATG	2 cut(s)	86, 200
FaiI	YATR	6 cut(s)	84, 158, 184, 198, 206, 534
FatI	CATG	2 cut(s)	82, 196
FauI	CCCGC	1 cut(s)	121
Fnu4HI	GCNGC	5 cut(s)	192, 328, 343, 444, 447
FokI	GGATG	1 cut(s)	409
FriOI	GRGCYC	1 cut(s)	73
Fsp4HI	GCNGC	5 cut(s)	192, 328, 343, 444, 447
FspBI	CTAG	1 cut(s)	492
GluI	GCNGC	5 cut(s)	192, 328, 343, 444, 447
GsaI	CCCAGC	1 cut(s)	109
HaeIII	GGCC	3 cut(s)	35, 354, 457
HapII	CCGG	1 cut(s)	144
Hin1II	CATG	2 cut(s)	86, 200
HindIII	AAGCTT	1 cut(s)	151
HinfI	GANTC	2 cut(s)	236, 309
HpaII	CCGG	1 cut(s)	144
Hpy166II	GTNNAC	2 cut(s)	79, 270
Hpy188I	TCNGA	7 cut(s)	68, 92, 124, 164, 258, 263, 427
Hpy188III	TCNNGA	1 cut(s)	386
Hpy8I	GTNNAC	2 cut(s)	79, 270
Hpy99I	CGWCG	1 cut(s)	92
HpyAV	CCTTC	4 cut(s)	7, 299, 446, 477
HpyCH4III	ACNGT	1 cut(s)	403
HpyCH4IV	ACGT	1 cut(s)	366
HpyCH4V	TGCA	5 cut(s)	182, 191, 345, 437, 446
HpyF10VI	GCNNNNNNNGC	4 cut(s)	188, 285, 351, 443
HpyF3I	CTNAG	2 cut(s)	336, 485
HpySE526I	ACGT	1 cut(s)	366
Hsp92II	CATG	2 cut(s)	86, 200
Kzo9I	GATC	7 cut(s)	97, 109, 124, 258, 388, 392, 429
LmnI	GCTCC	1 cut(s)	68
LpnPI	CCDG	7 cut(s)	46, 91, 157, 160, 348, 371, 456
Lsp1109I	GCAGC	5 cut(s)	203, 329, 339, 430, 458
MaeI	CTAG	1 cut(s)	492
MaeII	ACGT	1 cut(s)	366
MaeIII	GTNAC	1 cut(s)	360
MalI	GATC	7 cut(s)	99, 111, 126, 260, 390, 394, 431
MboI	GATC	7 cut(s)	97, 109, 124, 258, 388, 392, 429
MflI	RGATCY	2 cut(s)	109, 429
MhlI	GDGCHC	1 cut(s)	73
MlsI	TGGCCA	1 cut(s)	35
MluCI	AATT	1 cut(s)	230
MluNI	TGGCCA	1 cut(s)	35
MlyI	GAGTC	1 cut(s)	303
MmeI	TCCRAC	3 cut(s)	46, 70, 142
MnlI	CCTC	6 cut(s)	47, 86, 151, 220, 365, 390
Mox20I	TGGCCA	1 cut(s)	35
MscI	TGGCCA	1 cut(s)	35
MslI	CAYNNNNRTG	1 cut(s)	293
Msp20I	TGGCCA	1 cut(s)	35
MspA1I	CMGCKG	1 cut(s)	449
MspI	CCGG	1 cut(s)	144
MwoI	GCNNNNNNNGC	4 cut(s)	188, 285, 351, 443
NdeII	GATC	7 cut(s)	97, 109, 124, 258, 388, 392, 429
NlaIII	CATG	2 cut(s)	86, 200
NlaIV	GGNNCC	1 cut(s)	111
NspV	TTCGAA	1 cut(s)	234
PfeI	GAWTC	1 cut(s)	236
PkrI	GCNGC	5 cut(s)	193, 329, 344, 445, 448
PleI	GAGTC	1 cut(s)	303
PpsI	GAGTC	1 cut(s)	303
Psp124BI	GAGCTC	1 cut(s)	73
PspFI	CCCAGC	1 cut(s)	105
PspN4I	GGNNCC	1 cut(s)	111
PspPI	GGNCC	2 cut(s)	138, 455
PstI	CTGCAG	2 cut(s)	193, 448
PsuI	RGATCY	2 cut(s)	109, 429
PvuII	CAGCTG	1 cut(s)	449
RseI	CAYNNNNRTG	1 cut(s)	293
SacI	GAGCTC	1 cut(s)	73
SatI	GCNGC	5 cut(s)	192, 328, 343, 444, 447
Sau3AI	GATC	7 cut(s)	97, 109, 124, 258, 388, 392, 429
Sau96I	GGNCC	2 cut(s)	138, 455
SchI	GAGTC	1 cut(s)	303
SduI	GDGCHC	1 cut(s)	73
SetI	ASST	7 cut(s)	18, 73, 155, 344, 369, 451, 481
SfcI	CTRYAG	2 cut(s)	189, 444
SfuI	TTCGAA	1 cut(s)	234
SinI	GGWCC	1 cut(s)	138
SmiMI	CAYNNNNRTG	1 cut(s)	293
SmlI	CTYRAG	2 cut(s)	72, 356
SmoI	CTYRAG	2 cut(s)	72, 356
Sse9I	AATT	1 cut(s)	230
SsiI	CCGC	2 cut(s)	114, 313
SspMI	CTAG	1 cut(s)	492
SstI	GAGCTC	1 cut(s)	73
StyI	CCWWGG	1 cut(s)	49
TaaI	ACNGT	1 cut(s)	403
TaiI	ACGT	1 cut(s)	369
TaqI	TCGA	2 cut(s)	234, 391
TasI	AATT	1 cut(s)	230
TfiI	GAWTC	1 cut(s)	236
TseI	GCWGC	5 cut(s)	191, 327, 342, 443, 446
TspDTI	ATGAA	1 cut(s)	193
VpaK11BI	GGWCC	1 cut(s)	138
XapI	RAATTY	1 cut(s)	230
XspI	CTAG	1 cut(s)	492

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.