Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0042424.1

Orthogroup ID

OG0002848

Physical Location & Seq

Genomic Coordinates Forward (+)

13857 .. 16595

Gene Structure 2739 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0042424.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1239 bp

atggtagagtcattgccaaacaagatgacagaagaatttgatgatcatagaaaatgggataaggaaaagagtcatgacagtttttctcaggaaattaatcacaatttggaaaaatctcctgctaagggtattggtaatgcagatattgaagtcatggaagccaatttggaggaggaaatgctaattttagaccaagagtgtatgaatctgggagatgagcagagaaggcttgaacgtaatgtagaatccgtaagcagtgagatgttcactgaatgtcaggagctgttgcaaatgtttggtataccatacattattgcaccaatggaagcagaagctcagtgtgcatatttggaacttgcgaaccttgttgatggtgttgtgactgatgactctgatgtgttcttgtttggggcgcgaagtgtttacaaaaatatttttgatgatcgaaaatacgttgagacatattttatgaaggacattgagagtgagcttggcttaacgagagagaagctaattcgtatggcacttcttcttgggagtgattatactgaaggggttagtgggattggcattgtcaatgctattgaggttgtaaatgcatttcctgaggaggatggcctccataaatttcggaattggattgaatcacctgatcctaccattctaggtaagttggacgcagagtctggatcaagtgccaggaaaagagggtcaaagtttgggaagaatgatacaaataatacaaagagccatatggatgaagtctcagatcttgagaaaagcaattgtcaagatcaagaacacaagcagtcagatgatccgactgagggtgtgaagcaaattttcatggagaagcatagaaaagtgagcaaaaattggcatattcccctatcttttccaagtgacgcagttacttctgcttatacttgtccacaagtggacaagtcaactgagcctttcacatggggaaagccagatcatttggttcttcgcaagaaccagatcgatgagggtatagtgggtcaggcctatggtggtctgaagcttgaatcccctcgaagtatctacctatctgttttctggaatctcctgtttcctaaatattgtggggttcagcagaaggctccagtttcaaattatccagcctgggtctgcaaatcgtgtctggtgtatttctggatatctaaaataaaaatgacgaaaattaaggcacctgtatactccactttagaaaagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03420 map03420

Pfam Domains

Protein Families

XPG_I XPG_N

Protein Analysis

412

Amino Acids

46.92

Weight (kDa)

4.99

Isoelectric Point (pI)

50.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002848)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G28030 AT3G28030 AT3G28030 AT3G28030
fragaria_vesca	FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430 FvH4_6g50430
malus_domestica	MD17G1038000.v1.1
prunus_persica	Prupe.3G281300_v2.0.a1 Prupe.3G281300_v2.0.a1 Prupe.3G281300_v2.0.a1 Prupe.3G281300_v2.0.a1 Prupe.3G281300_v2.0.a1
pyrus_communis	pycom17g03420
rosa_chinensis	RchiOBHm_Chr2g0170851
rosa_laevigata	RLG00000021986
rosa_multiflora	Rmu_co8355801.1_g000001 Rmu_sc0009938.1_g000007 Rmu_sc0032006.1_g000001 Rmu_sc0035429.1_g000001 Rmu_sc0042424.1_g000002
rosa_roxburghii	Rroxscaffold_2G00081030
rosa_rugosa	Rorug02G0551800
rosa_samantha	Rh2AG624500 Rh2BG635100 Rh2CG603900 Rh2DG646700
rosa_wichuraiana	Rw2G051730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	1210
AccI	GTMKAC	2 cut(s)	301, 1218
AccII	CGCG	1 cut(s)	415
AclWI	GGATC	3 cut(s)	647, 697, 812
AcsI	RAATTY	3 cut(s)	35, 626, 840
AcuI	CTGAAG	2 cut(s)	570, 1061
AfiI	CCNNNNNNNGG	2 cut(s)	125, 827
AgsI	TTSAA	5 cut(s)	149, 233, 644, 1049, 1134
AhdI	GACNNNNNGTC	1 cut(s)	682
AjnI	CCWGG	2 cut(s)	698, 1145
AluBI	AGCT	5 cut(s)	283, 335, 490, 511, 1045
AluI	AGCT	5 cut(s)	283, 335, 490, 511, 1045
Alw26I	GTCTC	2 cut(s)	452, 769
AlwI	GGATC	3 cut(s)	647, 697, 812
AlwNI	CAGNNNCTG	2 cut(s)	283, 686
AoxI	GGCC	2 cut(s)	616, 1026
ApoI	RAATTY	3 cut(s)	35, 626, 840
AseI	ATTAAT	1 cut(s)	96
AspLEI	GCGC	1 cut(s)	415
AsuHPI	GGTGA	1 cut(s)	639
AxyI	CCTNAGG	1 cut(s)	606
BanI	GGYRCC	1 cut(s)	1210
BccI	CCATC	2 cut(s)	365, 608
BciT130I	CCWGG	2 cut(s)	700, 1147
BclI	TGATCA	1 cut(s)	43
BcoDI	GTCTC	2 cut(s)	452, 769
BfaI	CTAG	1 cut(s)	665
BglII	AGATCT	1 cut(s)	769
Bme1390I	CCNGG	2 cut(s)	700, 1147
BmeRI	GACNNNNNGTC	1 cut(s)	682
BmiI	GGNNCC	2 cut(s)	1125, 1212
BmrFI	CCNGG	2 cut(s)	700, 1147
BpmI	CTGGAG	1 cut(s)	1110
Bpu10I	CCTNAGC	1 cut(s)	123
BpuEI	CTTGAG	1 cut(s)	794
Bsa29I	ATCGAT	1 cut(s)	1005
BsaJI	CCNNGG	1 cut(s)	1146
Bsc4I	CCNNNNNNNGG	2 cut(s)	125, 827
Bse1I	ACTGG	1 cut(s)	1127
Bse21I	CCTNAGG	1 cut(s)	606
Bse3DI	GCAATG	1 cut(s)	11
BseBI	CCWGG	2 cut(s)	700, 1147
BseCI	ATCGAT	1 cut(s)	1005
BseDI	CCNNGG	1 cut(s)	1146
BseGI	GGATG	2 cut(s)	619, 763
BseLI	CCNNNNNNNGG	2 cut(s)	125, 827
BseMI	GCAATG	1 cut(s)	11
BseMII	CTCAG	6 cut(s)	101, 350, 597, 780, 816, 942
BseNI	ACTGG	1 cut(s)	1127
BseRI	GAGGAG	2 cut(s)	185, 623
Bsh1236I	CGCG	1 cut(s)	415
BshFI	GGCC	2 cut(s)	618, 1028
BshNI	GGYRCC	1 cut(s)	1210
BshVI	ATCGAT	1 cut(s)	1005
BslI	CCNNNNNNNGG	2 cut(s)	125, 827
BsmAI	GTCTC	2 cut(s)	452, 769
BsnI	GGCC	2 cut(s)	618, 1028
Bsp143I	GATC	9 cut(s)	43, 442, 652, 689, 769, 793, 817, 976, 1002
BspANI	GGCC	2 cut(s)	618, 1028
BspCNI	CTCAG	6 cut(s)	100, 349, 598, 779, 817, 943
BspDI	ATCGAT	1 cut(s)	1005
BspFNI	CGCG	1 cut(s)	415
BspHI	TCATGA	1 cut(s)	73
BspLI	GGNNCC	2 cut(s)	1125, 1212
BspPI	GGATC	3 cut(s)	647, 697, 812
BspT107I	GGYRCC	1 cut(s)	1210
BsrDI	GCAATG	1 cut(s)	11
BsrI	ACTGG	1 cut(s)	1127
BssECI	CCNNGG	1 cut(s)	1146
BssMI	GATC	9 cut(s)	43, 442, 652, 689, 769, 793, 817, 976, 1002
BssNAI	GTATAC	2 cut(s)	302, 1219
Bst1107I	GTATAC	2 cut(s)	302, 1219
Bst2UI	CCWGG	2 cut(s)	700, 1147
Bst4CI	ACNGT	1 cut(s)	80
BstDEI	CTNAG	7 cut(s)	87, 123, 336, 606, 766, 825, 951
BstF5I	GGATG	2 cut(s)	619, 763
BstFNI	CGCG	1 cut(s)	415
BstHHI	GCGC	1 cut(s)	415
BstKTI	GATC	9 cut(s)	46, 445, 655, 692, 772, 796, 820, 979, 1005
BstMAI	GTCTC	2 cut(s)	452, 769
BstMBI	GATC	9 cut(s)	43, 442, 652, 689, 769, 793, 817, 976, 1002
BstMWI	GCNNNNNNNGC	2 cut(s)	226, 341
BstNI	CCWGG	2 cut(s)	700, 1147
BstSCI	CCNGG	2 cut(s)	698, 1145
BstUI	CGCG	1 cut(s)	415
BstX2I	RGATCY	1 cut(s)	769
BstYI	RGATCY	1 cut(s)	769
BstZ17I	GTATAC	2 cut(s)	302, 1219
Bsu15I	ATCGAT	1 cut(s)	1005
Bsu36I	CCTNAGG	1 cut(s)	606
BsuRI	GGCC	2 cut(s)	618, 1028
BsuTUI	ATCGAT	1 cut(s)	1005
BtsCI	GGATG	2 cut(s)	619, 763
BtsI	GCAGTG	1 cut(s)	262
BtsIMutI	CAGTG	3 cut(s)	262, 267, 344
CaiI	CAGNNNCTG	2 cut(s)	283, 686
CciI	TCATGA	1 cut(s)	73
CfoI	GCGC	1 cut(s)	415
ClaI	ATCGAT	1 cut(s)	1005
CseI	GACGC	2 cut(s)	686, 914
CviAII	CATG	4 cut(s)	74, 154, 847, 963
DdeI	CTNAG	7 cut(s)	87, 123, 336, 606, 766, 825, 951
DpnI	GATC	9 cut(s)	45, 444, 654, 691, 771, 795, 819, 978, 1004
DpnII	GATC	9 cut(s)	43, 442, 652, 689, 769, 793, 817, 976, 1002
DriI	GACNNNNNGTC	1 cut(s)	682
Eam1105I	GACNNNNNGTC	1 cut(s)	682
Eco147I	AGGCCT	1 cut(s)	1028
Eco32I	GATATC	1 cut(s)	1182
Eco57I	CTGAAG	2 cut(s)	570, 1061
Eco81I	CCTNAGG	1 cut(s)	606
EcoRII	CCWGG	2 cut(s)	698, 1145
EcoRV	GATATC	1 cut(s)	1182
EcoT22I	ATGCAT	1 cut(s)	601
FaeI	CATG	4 cut(s)	77, 157, 850, 966
FatI	CATG	4 cut(s)	73, 153, 846, 962
FauNDI	CATATG	1 cut(s)	753
FbaI	TGATCA	1 cut(s)	43
FblI	GTMKAC	2 cut(s)	301, 1218
FokI	GGATG	2 cut(s)	626, 770
FspBI	CTAG	1 cut(s)	665
GlaI	GCGC	1 cut(s)	414
GsuI	CTGGAG	1 cut(s)	1110
HaeIII	GGCC	2 cut(s)	618, 1028
HgaI	GACGC	2 cut(s)	686, 914
HhaI	GCGC	1 cut(s)	415
Hin1II	CATG	4 cut(s)	77, 157, 850, 966
Hin6I	GCGC	1 cut(s)	413
HinP1I	GCGC	1 cut(s)	413
HincII	GTYRAC	1 cut(s)	948
HindII	GTYRAC	1 cut(s)	948
HindIII	AAGCTT	1 cut(s)	1043
HinfI	GANTC	9 cut(s)	8, 70, 205, 245, 389, 644, 683, 1049, 1084
HphI	GGTGA	1 cut(s)	639
Hpy166II	GTNNAC	7 cut(s)	267, 302, 424, 932, 940, 948, 1219
Hpy188I	TCNGA	6 cut(s)	394, 633, 769, 814, 822, 1041
Hpy8I	GTNNAC	7 cut(s)	267, 302, 424, 932, 940, 948, 1219
HpyAV	CCTTC	4 cut(s)	219, 466, 545, 1114
HpyCH4III	ACNGT	1 cut(s)	80
HpyCH4IV	ACGT	2 cut(s)	235, 453
HpyCH4V	TGCA	6 cut(s)	140, 289, 317, 344, 599, 1155
HpyF10VI	GCNNNNNNNGC	2 cut(s)	226, 341
HpyF3I	CTNAG	7 cut(s)	87, 123, 336, 606, 766, 825, 951
HpySE526I	ACGT	2 cut(s)	235, 453
Hsp92II	CATG	4 cut(s)	77, 157, 850, 966
HspAI	GCGC	1 cut(s)	413
Ksp22I	TGATCA	1 cut(s)	43
Kzo9I	GATC	9 cut(s)	43, 442, 652, 689, 769, 793, 817, 976, 1002
LmnI	GCTCC	2 cut(s)	280, 1129
MaeI	CTAG	1 cut(s)	665
MaeII	ACGT	2 cut(s)	235, 453
MaeIII	GTNAC	3 cut(s)	379, 902, 910
MalI	GATC	9 cut(s)	45, 444, 654, 691, 771, 795, 819, 978, 1004
MboI	GATC	9 cut(s)	43, 442, 652, 689, 769, 793, 817, 976, 1002
MboII	GAAGA	4 cut(s)	44, 521, 736, 980
MfeI	CAATTG	1 cut(s)	784
MflI	RGATCY	1 cut(s)	769
MlyI	GAGTC	4 cut(s)	17, 79, 383, 692
MmeI	TCCRAC	2 cut(s)	654, 845
Mph1103I	ATGCAT	1 cut(s)	601
MseI	TTAA	3 cut(s)	96, 497, 1206
MslI	CAYNNNNRTG	1 cut(s)	756
MspR9I	CCNGG	2 cut(s)	700, 1147
MunI	CAATTG	1 cut(s)	784
MvaI	CCWGG	2 cut(s)	700, 1147
MvnI	CGCG	1 cut(s)	415
MwoI	GCNNNNNNNGC	2 cut(s)	226, 341
NdeI	CATATG	1 cut(s)	753
NdeII	GATC	9 cut(s)	43, 442, 652, 689, 769, 793, 817, 976, 1002
NlaIII	CATG	4 cut(s)	77, 157, 850, 966
NlaIV	GGNNCC	2 cut(s)	1125, 1212
NmuCI	GTSAC	2 cut(s)	379, 902
NsiI	ATGCAT	1 cut(s)	601
PagI	TCATGA	1 cut(s)	73
PceI	AGGCCT	1 cut(s)	1028
PfeI	GAWTC	5 cut(s)	205, 245, 644, 1049, 1084
PleI	GAGTC	4 cut(s)	16, 78, 383, 691
PpsI	GAGTC	4 cut(s)	16, 78, 383, 691
PshBI	ATTAAT	1 cut(s)	96
Psp6I	CCWGG	2 cut(s)	698, 1145
PspGI	CCWGG	2 cut(s)	698, 1145
PspN4I	GGNNCC	2 cut(s)	1125, 1212
PstNI	CAGNNNCTG	2 cut(s)	283, 686
PsuI	RGATCY	1 cut(s)	769
RseI	CAYNNNNRTG	1 cut(s)	756
SaqAI	TTAA	3 cut(s)	96, 497, 1206
Sau3AI	GATC	9 cut(s)	43, 442, 652, 689, 769, 793, 817, 976, 1002
SchI	GAGTC	4 cut(s)	17, 79, 383, 692
ScrFI	CCNGG	2 cut(s)	700, 1147
SmiMI	CAYNNNNRTG	1 cut(s)	756
SmlI	CTYRAG	1 cut(s)	773
SmoI	CTYRAG	1 cut(s)	773
SseBI	AGGCCT	1 cut(s)	1028
SspI	AATATT	2 cut(s)	433, 1103
SspMI	CTAG	1 cut(s)	665
StuI	AGGCCT	1 cut(s)	1028
StyD4I	CCNGG	2 cut(s)	698, 1145
TaaI	ACNGT	1 cut(s)	80
TaiI	ACGT	2 cut(s)	238, 456
TaqI	TCGA	3 cut(s)	445, 1005, 1057
TfiI	GAWTC	5 cut(s)	205, 245, 644, 1049, 1084
Tru1I	TTAA	3 cut(s)	96, 497, 1206
Tru9I	TTAA	3 cut(s)	96, 497, 1206
TscAI	CASTG	3 cut(s)	262, 274, 344
TseFI	GTSAC	2 cut(s)	379, 902
Tsp45I	GTSAC	2 cut(s)	379, 902
TspDTI	ATGAA	4 cut(s)	218, 485, 774, 835
TspGWI	ACGGA	1 cut(s)	238
TspRI	CASTG	3 cut(s)	262, 274, 344
VspI	ATTAAT	1 cut(s)	96
XapI	RAATTY	3 cut(s)	35, 626, 840
XmiI	GTMKAC	2 cut(s)	301, 1218
XspI	CTAG	1 cut(s)	665
Zsp2I	ATGCAT	1 cut(s)	601

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.