Rmu_sc0042965.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042965.1
OG0008135
Physical Location & Seq
Forward (+)
1 .. 2314
2314 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042965.1_g000001.1.cds

Sequence Viewer

Length: 651 bp
gcgtccagtgcagggagctcgattctcagtgaaggaaatggaggtgtcaaagtttcaggtattcggaaatcttcatctgaagatgctggtttgattgattatgtctatcagtgtgctcccagggaaatcgagatgctgtgtgagaattctgaaatacataaaggcactggatctttgggtttgactggtgtagaaaggaagctaagggttcttaaaagaaaaccagcgtcatctttaagtggtagtgatgatgaaaacgggggtggcaattttaagaaagataaaaactcagacagtgagatgaagcaactccagaagttgagcattcagcctgatggtcctcttatcaagcaatgcacagaaatacttgatttttctggtagtaatgactctgaaaatcaaaatttaccaactcacgagcaagtgaactcaaggcaatctgaagagaaaattatggcagaacagacgtcacaaccttttcttaaggctcctatggaggtgagtagtgcttttgatgatgatcctcatgccgatcttagttctagttgcagttcaagctcctctgactctgaagatgactgtctactactatctgcacttgatgatattatgccaaaagccaaagcaagagaggggagctgttctgtctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

216

Amino Acids

23.05

Weight (kDa)

4.68

Isoelectric Point (pI)

58.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 470
AccI GTMKAC 1 cut(s) 583
AclWI GGATC 2 cut(s) 178, 515
AcsI RAATTY 2 cut(s) 145, 403
AcuI CTGAAG 3 cut(s) 99, 462, 591
AcyI GRCGYC 1 cut(s) 467
AfiI CCNNNNNNNGG 1 cut(s) 12
AflII CTTAAG 1 cut(s) 482
AgsI TTSAA 1 cut(s) 555
AjnI CCWGG 1 cut(s) 119
AluBI AGCT 4 cut(s) 18, 202, 558, 639
AluI AGCT 4 cut(s) 18, 202, 558, 639
Alw21I GWGCWC 2 cut(s) 20, 118
AlwI GGATC 2 cut(s) 178, 515
ApoI RAATTY 2 cut(s) 145, 403
AspS9I GGNCC 1 cut(s) 338
AsuHPI GGTGA 1 cut(s) 511
AvaII GGWCC 1 cut(s) 338
BanII GRGCYC 1 cut(s) 20
BauI CACGAG 1 cut(s) 416
Bbv12I GWGCWC 2 cut(s) 20, 118
BccI CCATC 1 cut(s) 329
BcgI CGANNNNNNTGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 121
BfaI CTAG 1 cut(s) 543
BfrI CTTAAG 1 cut(s) 482
Bme1390I CCNGG 1 cut(s) 121
Bme18I GGWCC 1 cut(s) 338
BmgT120I GGNCC 1 cut(s) 338
BmiI GGNNCC 1 cut(s) 489
BmrFI CCNGG 1 cut(s) 121
BmsI GCATC 2 cut(s) 73, 123
BpmI CTGGAG 1 cut(s) 296
Bpu10I CCTNAGC 1 cut(s) 203
BpuEI CTTGAG 1 cut(s) 415
BsaBI GATNNNNATC 1 cut(s) 519
BsaHI GRCGYC 1 cut(s) 467
BsaJI CCNNGG 2 cut(s) 119, 120
Bsc4I CCNNNNNNNGG 1 cut(s) 12
Bse1I ACTGG 3 cut(s) 6, 172, 190
Bse3DI GCAATG 1 cut(s) 359
Bse8I GATNNNNATC 1 cut(s) 519
BseBI CCWGG 1 cut(s) 121
BseDI CCNNGG 2 cut(s) 119, 120
BseJI GATNNNNATC 1 cut(s) 519
BseLI CCNNNNNNNGG 1 cut(s) 12
BseMI GCAATG 1 cut(s) 359
BseMII CTCAG 2 cut(s) 40, 303
BseNI ACTGG 3 cut(s) 6, 172, 190
BseRI GAGGAG 1 cut(s) 550
BsgI GTGCAG 2 cut(s) 30, 579
BsiHKAI GWGCWC 2 cut(s) 20, 118
BslI CCNNNNNNNGG 1 cut(s) 12
BsmI GAATGC 1 cut(s) 324
Bsp1286I GDGCHC 2 cut(s) 20, 118
Bsp143I GATC 3 cut(s) 170, 520, 532
BspCNI CTCAG 2 cut(s) 39, 302
BspLI GGNNCC 1 cut(s) 489
BspPI GGATC 2 cut(s) 178, 515
BspTI CTTAAG 1 cut(s) 482
BsrDI GCAATG 1 cut(s) 359
BsrI ACTGG 3 cut(s) 6, 172, 190
BssECI CCNNGG 2 cut(s) 119, 120
BssMI GATC 3 cut(s) 170, 520, 532
BssNI GRCGYC 1 cut(s) 467
BssSI CACGAG 1 cut(s) 416
Bst2BI CACGAG 1 cut(s) 416
Bst2UI CCWGG 1 cut(s) 121
Bst4CI ACNGT 2 cut(s) 296, 581
Bst6I CTCTTC 1 cut(s) 438
BstACI GRCGYC 1 cut(s) 467
BstAFI CTTAAG 1 cut(s) 482
BstDEI CTNAG 4 cut(s) 26, 203, 289, 536
BstKTI GATC 3 cut(s) 173, 523, 535
BstMBI GATC 3 cut(s) 170, 520, 532
BstMWI GCNNNNNNNGC 2 cut(s) 8, 555
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
BstX2I RGATCY 1 cut(s) 170
BstYI RGATCY 1 cut(s) 170
BtsIMutI CAGTG 5 cut(s) 13, 34, 116, 165, 301
Cfr13I GGNCC 1 cut(s) 338
CseI GACGC 1 cut(s) 216
CviAII CATG 1 cut(s) 527
CviJI RGCY 7 cut(s) 18, 202, 331, 488, 558, 620, 639
CviKI_1 RGCY 7 cut(s) 18, 202, 331, 488, 558, 620, 639
DdeI CTNAG 4 cut(s) 26, 203, 289, 536
DpnI GATC 3 cut(s) 172, 522, 534
DpnII GATC 3 cut(s) 170, 520, 532
Eam1104I CTCTTC 1 cut(s) 438
EarI CTCTTC 1 cut(s) 438
Ecl136II GAGCTC 1 cut(s) 18
Eco24I GRGCYC 1 cut(s) 20
Eco47I GGWCC 1 cut(s) 338
Eco53kI GAGCTC 1 cut(s) 18
Eco57I CTGAAG 3 cut(s) 99, 462, 591
EcoICRI GAGCTC 1 cut(s) 18
EcoRI GAATTC 1 cut(s) 145
EcoRII CCWGG 1 cut(s) 119
EcoT38I GRGCYC 1 cut(s) 20
FaeI CATG 1 cut(s) 530
FaiI YATR 6 cut(s) 102, 159, 455, 494, 528, 611
FatI CATG 1 cut(s) 526
FblI GTMKAC 1 cut(s) 583
FriOI GRGCYC 1 cut(s) 20
FspBI CTAG 1 cut(s) 543
GsuI CTGGAG 1 cut(s) 296
HgaI GACGC 1 cut(s) 216
Hin1I GRCGYC 1 cut(s) 467
Hin1II CATG 1 cut(s) 530
HinfI GANTC 3 cut(s) 22, 389, 566
HphI GGTGA 1 cut(s) 511
Hpy166II GTNNAC 2 cut(s) 427, 584
Hpy188I TCNGA 8 cut(s) 66, 79, 151, 292, 394, 442, 565, 571
Hpy188III TCNNGA 3 cut(s) 130, 313, 416
Hpy8I GTNNAC 2 cut(s) 427, 584
HpyAV CCTTC 1 cut(s) 26
HpyCH4III ACNGT 2 cut(s) 296, 581
HpyCH4IV ACGT 1 cut(s) 467
HpyCH4V TGCA 4 cut(s) 11, 357, 549, 596
HpyF10VI GCNNNNNNNGC 2 cut(s) 8, 555
HpyF3I CTNAG 4 cut(s) 26, 203, 289, 536
HpySE526I ACGT 1 cut(s) 467
Hsp92I GRCGYC 1 cut(s) 467
Hsp92II CATG 1 cut(s) 530
Kzo9I GATC 3 cut(s) 170, 520, 532
LmnI GCTCC 5 cut(s) 15, 121, 493, 563, 636
LweI GCATC 2 cut(s) 73, 123
MaeI CTAG 1 cut(s) 543
MaeII ACGT 1 cut(s) 467
MaeIII GTNAC 1 cut(s) 468
MalI GATC 3 cut(s) 172, 522, 534
MboI GATC 3 cut(s) 170, 520, 532
MboII GAAGA 4 cut(s) 63, 92, 455, 584
MflI RGATCY 1 cut(s) 170
MhlI GDGCHC 2 cut(s) 20, 118
MluCI AATT 4 cut(s) 145, 268, 403, 450
MlyI GAGTC 2 cut(s) 383, 560
MnlI CCTC 6 cut(s) 35, 351, 490, 534, 571, 625
MseI TTAA 4 cut(s) 213, 236, 273, 483
MspCI CTTAAG 1 cut(s) 482
MspR9I CCNGG 1 cut(s) 121
Mva1269I GAATGC 1 cut(s) 324
MvaI CCWGG 1 cut(s) 121
MwoI GCNNNNNNNGC 2 cut(s) 8, 555
NdeII GATC 3 cut(s) 170, 520, 532
NlaIII CATG 1 cut(s) 530
NlaIV GGNNCC 1 cut(s) 489
NmuCI GTSAC 1 cut(s) 468
PasI CCCWGGG 1 cut(s) 120
PctI GAATGC 1 cut(s) 324
PfeI GAWTC 1 cut(s) 22
PleI GAGTC 2 cut(s) 383, 560
PpsI GAGTC 2 cut(s) 383, 560
Psp124BI GAGCTC 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
PspN4I GGNNCC 1 cut(s) 489
PspPI GGNCC 1 cut(s) 338
PsuI RGATCY 1 cut(s) 170
SacI GAGCTC 1 cut(s) 20
SaqAI TTAA 4 cut(s) 213, 236, 273, 483
Sau3AI GATC 3 cut(s) 170, 520, 532
Sau96I GGNCC 1 cut(s) 338
SchI GAGTC 2 cut(s) 383, 560
ScrFI CCNGG 1 cut(s) 121
SduI GDGCHC 2 cut(s) 20, 118
SetI ASST 9 cut(s) 20, 46, 61, 204, 470, 478, 501, 560, 641
SfaNI GCATC 2 cut(s) 73, 123
SinI GGWCC 1 cut(s) 338
SmlI CTYRAG 2 cut(s) 430, 482
SmoI CTYRAG 2 cut(s) 430, 482
Sse9I AATT 4 cut(s) 145, 268, 403, 450
SspMI CTAG 1 cut(s) 543
SstI GAGCTC 1 cut(s) 20
StyD4I CCNGG 1 cut(s) 119
TaaI ACNGT 2 cut(s) 296, 581
TaiI ACGT 1 cut(s) 470
TaqI TCGA 2 cut(s) 20, 129
TasI AATT 4 cut(s) 145, 268, 403, 450
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 4 cut(s) 213, 236, 273, 483
Tru9I TTAA 4 cut(s) 213, 236, 273, 483
TscAI CASTG 5 cut(s) 13, 34, 116, 172, 301
TseFI GTSAC 1 cut(s) 468
Tsp45I GTSAC 1 cut(s) 468
TspDTI ATGAA 3 cut(s) 63, 267, 317
TspRI CASTG 5 cut(s) 13, 34, 116, 172, 301
Vha464I CTTAAG 1 cut(s) 482
VpaK11BI GGWCC 1 cut(s) 338
XapI RAATTY 2 cut(s) 145, 403
XmiI GTMKAC 1 cut(s) 583
XspI CTAG 1 cut(s) 543
ZraI GACGTC 1 cut(s) 468
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.