Rmu_ssc0000022.1_g000006

cytochrome

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000022.1
OG0011592
Physical Location & Seq
Forward (+)
22173 .. 24588
2416 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 612 bp
atgggatgtcttccgatggcaccacatttattgggtggcatcgacaacaacagtttgagtgccaccgatgctcttgatgcggcctgggcaacaaaatattggtcgggtcactatataatattggaggtaaggaacacaagttctaaccgctcaagggaggagctctgctgtgctgctcatcatcttcttctgtcatatacagagatggcttcagattctaaagtctatcactttgatgaggtggcgcagcacaagtacaagaaagattgctggattatagtctctggaaaggtttatgatgtcactccttttctggaggaacaccctggaggtgatgaagtcttgctattagcagctgatagggatgcaactgatgatttcaatgatgttggccacagcgattctgcaaaggagatgatggaaaagtactacgtaggcgaggttgacacatccacaataccagagcagccaaattacaagctgcctgcacaagcaacagctcctcaagctgaccaatcttctggatttgtggtaaaacttctacagtttctgctgcccttgttgatcttgggggctgcatttgctctgcaatactacagtaaaaagaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cyt-b5

Protein Analysis

203

Amino Acids

22.57

Weight (kDa)

5.05

Isoelectric Point (pI)

36.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cyt-b5 PF00173 79 - 148 2.6e-28 Cytochrome b5-like Heme/Steroid binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 19
AccBSI CCGCTC 1 cut(s) 150
AciI CCGC 2 cut(s) 80, 148
AcoI YGGCCR 1 cut(s) 391
AcuI CTGAAG 1 cut(s) 195
AfaI GTAC 2 cut(s) 257, 428
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 1 cut(s) 382
AjnI CCWGG 2 cut(s) 83, 325
AloI GAACNNNNNNTCC 2 cut(s) 124, 156
AluBI AGCT 5 cut(s) 163, 356, 481, 500, 509
AluI AGCT 5 cut(s) 163, 356, 481, 500, 509
Alw21I GWGCWC 1 cut(s) 165
Alw26I GTCTC 1 cut(s) 286
AlwNI CAGNNNCTG 1 cut(s) 550
AoxI GGCC 2 cut(s) 81, 391
ApeKI GCWGC 7 cut(s) 173, 247, 353, 466, 481, 553, 575
ArsI GACNNNNNNTTYG 2 cut(s) 86, 118
AspLEI GCGC 1 cut(s) 247
AsuHPI GGTGA 1 cut(s) 344
BalI TGGCCA 1 cut(s) 393
BanI GGYRCC 1 cut(s) 19
BanII GRGCYC 1 cut(s) 165
BbsI GAAGAC 1 cut(s) 2
Bbv12I GWGCWC 1 cut(s) 165
BbvI GCAGC 7 cut(s) 160, 259, 365, 468, 478, 540, 562
BccI CCATC 3 cut(s) 10, 199, 412
BciT130I CCWGG 2 cut(s) 85, 327
BcoDI GTCTC 1 cut(s) 286
BfmI CTRYAG 2 cut(s) 542, 595
BisI GCNGC 8 cut(s) 81, 174, 248, 354, 467, 482, 554, 576
BlsI GCNGC 8 cut(s) 82, 175, 249, 355, 468, 483, 555, 577
BmcAI AGTACT 1 cut(s) 428
Bme1390I CCNGG 2 cut(s) 85, 327
BmiI GGNNCC 1 cut(s) 21
BmrFI CCNGG 2 cut(s) 85, 327
BmsI GCATC 4 cut(s) 48, 58, 67, 355
BpiI GAAGAC 1 cut(s) 2
BpmI CTGGAG 2 cut(s) 335, 348
BpuEI CTTGAG 2 cut(s) 136, 489
BsaAI YACGTR 1 cut(s) 433
BsaJI CCNNGG 2 cut(s) 84, 325
Bsc4I CCNNNNNNNGG 1 cut(s) 154
BseBI CCWGG 2 cut(s) 85, 327
BseDI CCNNGG 2 cut(s) 84, 325
BseGI GGATG 3 cut(s) 11, 370, 449
BseLI CCNNNNNNNGG 1 cut(s) 154
BseRI GAGGAG 2 cut(s) 173, 492
BseXI GCAGC 7 cut(s) 160, 259, 365, 468, 478, 540, 562
BsgI GTGCAG 1 cut(s) 471
BshFI GGCC 2 cut(s) 83, 393
BshNI GGYRCC 1 cut(s) 19
BsiHKAI GWGCWC 1 cut(s) 165
BslI CCNNNNNNNGG 1 cut(s) 154
BsmAI GTCTC 1 cut(s) 286
BsnI GGCC 2 cut(s) 83, 393
Bsp1286I GDGCHC 1 cut(s) 165
Bsp143I GATC 1 cut(s) 564
BspACI CCGC 2 cut(s) 80, 148
BspANI GGCC 2 cut(s) 83, 393
BspLI GGNNCC 1 cut(s) 21
BspT107I GGYRCC 1 cut(s) 19
BsrBI CCGCTC 1 cut(s) 150
BssECI CCNNGG 2 cut(s) 84, 325
BssMI GATC 1 cut(s) 564
Bst2UI CCWGG 2 cut(s) 85, 327
Bst4CI ACNGT 3 cut(s) 53, 546, 599
BstBAI YACGTR 1 cut(s) 433
BstC8I GCNNGC 1 cut(s) 486
BstF5I GGATG 3 cut(s) 11, 370, 449
BstHHI GCGC 1 cut(s) 247
BstKTI GATC 1 cut(s) 567
BstMAI GTCTC 1 cut(s) 286
BstMBI GATC 1 cut(s) 564
BstMWI GCNNNNNNNGC 5 cut(s) 68, 77, 86, 506, 581
BstNI CCWGG 2 cut(s) 85, 327
BstSCI CCNGG 2 cut(s) 83, 325
BstSFI CTRYAG 2 cut(s) 542, 595
BstSNI TACGTA 1 cut(s) 433
BstV1I GCAGC 7 cut(s) 160, 259, 365, 468, 478, 540, 562
BstV2I GAAGAC 1 cut(s) 2
BstXI CCANNNNNNTGG 1 cut(s) 521
BsuRI GGCC 2 cut(s) 83, 393
BtsCI GGATG 3 cut(s) 11, 370, 449
Cac8I GCNNGC 1 cut(s) 486
CaiI CAGNNNCTG 1 cut(s) 550
CfoI GCGC 1 cut(s) 247
Csp6I GTAC 2 cut(s) 256, 427
CspCI CAANNNNNGTGG 2 cut(s) 12, 47
CviQI GTAC 2 cut(s) 256, 427
DpnI GATC 1 cut(s) 566
DpnII GATC 1 cut(s) 564
EaeI YGGCCR 1 cut(s) 391
Ecl136II GAGCTC 1 cut(s) 163
Eco105I TACGTA 1 cut(s) 433
Eco24I GRGCYC 1 cut(s) 165
Eco53kI GAGCTC 1 cut(s) 163
Eco57I CTGAAG 1 cut(s) 195
EcoICRI GAGCTC 1 cut(s) 163
EcoRII CCWGG 2 cut(s) 83, 325
EcoT38I GRGCYC 1 cut(s) 165
FaiI YATR 6 cut(s) 114, 116, 196, 198, 278, 297
Fnu4HI GCNGC 8 cut(s) 81, 174, 248, 354, 467, 482, 554, 576
FokI GGATG 3 cut(s) 18, 377, 436
FriOI GRGCYC 1 cut(s) 165
Fsp4HI GCNGC 8 cut(s) 81, 174, 248, 354, 467, 482, 554, 576
GlaI GCGC 1 cut(s) 246
GluI GCNGC 8 cut(s) 81, 174, 248, 354, 467, 482, 554, 576
GsuI CTGGAG 2 cut(s) 335, 348
HaeIII GGCC 2 cut(s) 83, 393
HhaI GCGC 1 cut(s) 247
Hin6I GCGC 1 cut(s) 245
HinP1I GCGC 1 cut(s) 245
HincII GTYRAC 1 cut(s) 445
HindII GTYRAC 1 cut(s) 445
HinfI GANTC 2 cut(s) 215, 401
HphI GGTGA 1 cut(s) 344
Hpy166II GTNNAC 1 cut(s) 445
Hpy188I TCNGA 2 cut(s) 15, 214
Hpy188III TCNNGA 4 cut(s) 74, 285, 314, 522
Hpy8I GTNNAC 1 cut(s) 445
HpyCH4III ACNGT 3 cut(s) 53, 546, 599
HpyCH4IV ACGT 1 cut(s) 432
HpyCH4V TGCA 5 cut(s) 368, 407, 488, 578, 589
HpyF10VI GCNNNNNNNGC 5 cut(s) 68, 77, 86, 506, 581
HpySE526I ACGT 1 cut(s) 432
HspAI GCGC 1 cut(s) 245
Kzo9I GATC 1 cut(s) 564
LmnI GCTCC 2 cut(s) 160, 505
Lsp1109I GCAGC 7 cut(s) 160, 259, 365, 468, 478, 540, 562
LweI GCATC 4 cut(s) 48, 58, 67, 355
MaeII ACGT 1 cut(s) 432
MaeIII GTNAC 2 cut(s) 107, 301
MalI GATC 1 cut(s) 566
MbiI CCGCTC 1 cut(s) 150
MboI GATC 1 cut(s) 564
MboII GAAGA 3 cut(s) 176, 179, 510
MhlI GDGCHC 1 cut(s) 165
MlsI TGGCCA 1 cut(s) 393
MluCI AATT 1 cut(s) 472
MluNI TGGCCA 1 cut(s) 393
MnlI CCTC 7 cut(s) 118, 151, 232, 310, 323, 433, 513
Mox20I TGGCCA 1 cut(s) 393
MscI TGGCCA 1 cut(s) 393
MslI CAYNNNNRTG 1 cut(s) 234
Msp20I TGGCCA 1 cut(s) 393
MspA1I CMGCKG 1 cut(s) 356
MspR9I CCNGG 2 cut(s) 85, 327
MvaI CCWGG 2 cut(s) 85, 327
MwoI GCNNNNNNNGC 5 cut(s) 68, 77, 86, 506, 581
NdeII GATC 1 cut(s) 564
NlaIV GGNNCC 1 cut(s) 21
NmuCI GTSAC 2 cut(s) 107, 301
PfeI GAWTC 2 cut(s) 215, 401
PkrI GCNGC 8 cut(s) 82, 175, 249, 355, 468, 483, 555, 577
Ppu21I YACGTR 1 cut(s) 433
Psp124BI GAGCTC 1 cut(s) 165
Psp6I CCWGG 2 cut(s) 83, 325
PspGI CCWGG 2 cut(s) 83, 325
PspN4I GGNNCC 1 cut(s) 21
PstNI CAGNNNCTG 1 cut(s) 550
PvuII CAGCTG 1 cut(s) 356
RsaI GTAC 2 cut(s) 257, 428
RsaNI GTAC 2 cut(s) 256, 427
RseI CAYNNNNRTG 1 cut(s) 234
SacI GAGCTC 1 cut(s) 165
SatI GCNGC 8 cut(s) 81, 174, 248, 354, 467, 482, 554, 576
Sau3AI GATC 1 cut(s) 564
ScaI AGTACT 1 cut(s) 428
ScrFI CCNGG 2 cut(s) 85, 327
SduI GDGCHC 1 cut(s) 165
SfaNI GCATC 4 cut(s) 48, 58, 67, 355
SfcI CTRYAG 2 cut(s) 542, 595
SmiMI CAYNNNNRTG 1 cut(s) 234
SmlI CTYRAG 2 cut(s) 151, 504
SmoI CTYRAG 2 cut(s) 151, 504
SnaBI TACGTA 1 cut(s) 433
Sse9I AATT 1 cut(s) 472
SsiI CCGC 2 cut(s) 80, 148
SspI AATATT 2 cut(s) 98, 120
SstI GAGCTC 1 cut(s) 165
StyD4I CCNGG 2 cut(s) 83, 325
TaaI ACNGT 3 cut(s) 53, 546, 599
TaiI ACGT 1 cut(s) 435
TaqI TCGA 1 cut(s) 42
TasI AATT 1 cut(s) 472
TatI WGTACW 2 cut(s) 255, 426
TauI GCSGC 1 cut(s) 83
TfiI GAWTC 2 cut(s) 215, 401
TseFI GTSAC 2 cut(s) 107, 301
TseI GCWGC 7 cut(s) 173, 247, 353, 466, 481, 553, 575
Tsp45I GTSAC 2 cut(s) 107, 301
TspDTI ATGAA 1 cut(s) 351
ZrmI AGTACT 1 cut(s) 428
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.