Rmu_ssc0000407.1_g000007

Belongs to the glycosyltransferase 31 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000407.1
Physical Location & Seq
Forward (+)
19444 .. 19896
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000407.1_g000007.1.cds

Sequence Viewer

Length: 345 bp
atgagggggaaacaggtttcaggaaaggcgatgctgattctatgtgttgcaagtttttttgcaggatcactgttcagtactacaagccgcacatggagtagtactagtactagtctagatggtgatgatgatcaacctaatggcggccgtgaagctcatccatttcctatcgtttccaagtaccacatccacaaccacctagacgaaacagccaattctaaaggggcagcagcactagtcacacaaactaattgcaatgatgatcacaagcgaaaactggttgaaggaaaatctggtgatgatattatgggggaggtggcaaagactcatcaagctatcaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.27

Weight (kDa)

7.01

Isoelectric Point (pI)

20.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 88, 144
AclWI GGATC 1 cut(s) 73
AcoI YGGCCR 1 cut(s) 145
AfaI GTAC 4 cut(s) 79, 103, 109, 182
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 1 cut(s) 284
AhlI ACTAGT 3 cut(s) 104, 110, 235
AluBI AGCT 2 cut(s) 155, 335
AluI AGCT 2 cut(s) 155, 335
AlwI GGATC 1 cut(s) 73
AoxI GGCC 1 cut(s) 145
ApeKI GCWGC 2 cut(s) 227, 230
AsuHPI GGTGA 2 cut(s) 134, 308
BbvI GCAGC 2 cut(s) 239, 242
BccI CCATC 1 cut(s) 113
BceAI ACGGC 1 cut(s) 132
BclI TGATCA 2 cut(s) 130, 262
BcuI ACTAGT 3 cut(s) 104, 110, 235
BfaI CTAG 5 cut(s) 105, 111, 116, 200, 236
BisI GCNGC 4 cut(s) 88, 145, 228, 231
BlsI GCNGC 4 cut(s) 89, 146, 229, 232
BmcAI AGTACT 3 cut(s) 79, 103, 109
BmsI GCATC 1 cut(s) 21
BsaBI GATNNNNATC 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse1I ACTGG 1 cut(s) 282
Bse3DI GCAATG 1 cut(s) 262
Bse8I GATNNNNATC 1 cut(s) 129
BseGI GGATG 2 cut(s) 157, 186
BseJI GATNNNNATC 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 143
BseMI GCAATG 1 cut(s) 262
BseNI ACTGG 1 cut(s) 282
BseX3I CGGCCG 1 cut(s) 145
BseXI GCAGC 2 cut(s) 239, 242
Bsh1285I CGRYCG 1 cut(s) 148
BshFI GGCC 1 cut(s) 147
BsiEI CGRYCG 1 cut(s) 148
BslI CCNNNNNNNGG 1 cut(s) 143
BsnI GGCC 1 cut(s) 147
Bsp143I GATC 3 cut(s) 65, 130, 262
BspACI CCGC 2 cut(s) 88, 144
BspANI GGCC 1 cut(s) 147
BspPI GGATC 1 cut(s) 73
BsrDI GCAATG 1 cut(s) 262
BsrI ACTGG 1 cut(s) 282
BssMI GATC 3 cut(s) 65, 130, 262
Bst4CI ACNGT 1 cut(s) 72
BstF5I GGATG 2 cut(s) 157, 186
BstKTI GATC 3 cut(s) 68, 133, 265
BstMBI GATC 3 cut(s) 65, 130, 262
BstMCI CGRYCG 1 cut(s) 148
BstV1I GCAGC 2 cut(s) 239, 242
BstZI CGGCCG 1 cut(s) 145
BsuRI GGCC 1 cut(s) 147
BtgZI GCGATG 1 cut(s) 44
BtsCI GGATG 2 cut(s) 157, 186
BtsIMutI CAGTG 1 cut(s) 68
Csp6I GTAC 4 cut(s) 78, 102, 108, 181
CviAII CATG 1 cut(s) 93
CviJI RGCY 5 cut(s) 87, 147, 155, 212, 335
CviKI_1 RGCY 5 cut(s) 87, 147, 155, 212, 335
CviQI GTAC 4 cut(s) 78, 102, 108, 181
DpnI GATC 3 cut(s) 67, 132, 264
DpnII GATC 3 cut(s) 65, 130, 262
EaeI YGGCCR 1 cut(s) 145
EagI CGGCCG 1 cut(s) 145
EclXI CGGCCG 1 cut(s) 145
Eco52I CGGCCG 1 cut(s) 145
FaeI CATG 1 cut(s) 96
FaiI YATR 3 cut(s) 43, 94, 308
FatI CATG 1 cut(s) 92
FbaI TGATCA 2 cut(s) 130, 262
Fnu4HI GCNGC 4 cut(s) 88, 145, 228, 231
FokI GGATG 2 cut(s) 144, 173
Fsp4HI GCNGC 4 cut(s) 88, 145, 228, 231
FspBI CTAG 5 cut(s) 105, 111, 116, 200, 236
GluI GCNGC 4 cut(s) 88, 145, 228, 231
HaeIII GGCC 1 cut(s) 147
Hin1II CATG 1 cut(s) 96
HinfI GANTC 2 cut(s) 37, 325
HphI GGTGA 2 cut(s) 134, 308
Hpy188III TCNNGA 2 cut(s) 21, 116
HpyAV CCTTC 1 cut(s) 278
HpyCH4III ACNGT 1 cut(s) 72
HpyCH4V TGCA 3 cut(s) 50, 62, 255
Hsp92II CATG 1 cut(s) 96
Ksp22I TGATCA 2 cut(s) 130, 262
Kzo9I GATC 3 cut(s) 65, 130, 262
LpnPI CCDG 4 cut(s) 6, 48, 263, 279
Lsp1109I GCAGC 2 cut(s) 239, 242
LweI GCATC 1 cut(s) 21
MaeI CTAG 5 cut(s) 105, 111, 116, 200, 236
MaeIII GTNAC 1 cut(s) 238
MalI GATC 3 cut(s) 67, 132, 264
MboI GATC 3 cut(s) 65, 130, 262
MluCI AATT 2 cut(s) 214, 250
MlyI GAGTC 1 cut(s) 319
MnlI CCTC 1 cut(s) 307
NdeII GATC 3 cut(s) 65, 130, 262
NlaIII CATG 1 cut(s) 96
NmuCI GTSAC 1 cut(s) 238
PfeI GAWTC 1 cut(s) 37
PkrI GCNGC 4 cut(s) 89, 146, 229, 232
PleI GAGTC 1 cut(s) 319
PpsI GAGTC 1 cut(s) 319
RsaI GTAC 4 cut(s) 79, 103, 109, 182
RsaNI GTAC 4 cut(s) 78, 102, 108, 181
SatI GCNGC 4 cut(s) 88, 145, 228, 231
Sau3AI GATC 3 cut(s) 65, 130, 262
ScaI AGTACT 3 cut(s) 79, 103, 109
SchI GAGTC 1 cut(s) 319
SetI ASST 6 cut(s) 18, 139, 157, 201, 318, 337
SfaNI GCATC 1 cut(s) 21
SpeI ACTAGT 3 cut(s) 104, 110, 235
Sse9I AATT 2 cut(s) 214, 250
SsiI CCGC 2 cut(s) 88, 144
SspMI CTAG 5 cut(s) 105, 111, 116, 200, 236
TaaI ACNGT 1 cut(s) 72
TasI AATT 2 cut(s) 214, 250
TatI WGTACW 3 cut(s) 77, 101, 107
TauI GCSGC 2 cut(s) 90, 147
TfiI GAWTC 1 cut(s) 37
TscAI CASTG 1 cut(s) 75
TseFI GTSAC 1 cut(s) 238
TseI GCWGC 2 cut(s) 227, 230
Tsp45I GTSAC 1 cut(s) 238
TspRI CASTG 1 cut(s) 75
XbaI TCTAGA 1 cut(s) 115
XspI CTAG 5 cut(s) 105, 111, 116, 200, 236
ZrmI AGTACT 3 cut(s) 79, 103, 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.