Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000432.1

Orthogroup ID

OG0015337

Physical Location & Seq

Genomic Coordinates Reverse (-)

39344 .. 41025

Gene Structure 1682 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000432.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 480 bp

atgggcaatacccttagaggcgggggtaccgaggagaggactagtgatattagtagcatagcagatgactactacgaggccaatatcaaaggcaatgaatcaactcaatcaagcatagctgagagtgggttctacagagctatatgcgaaatcgtcgaaaaaataaaccatcaacataataacacacaaattaacgtgccaacggaaaagaaactcaaggaagcatttaaggctaaccacagagaagggacaggaaaattgacaaaggaagagttcggaagatgtgtgcaacaagtgataagggaagcagggatcagtggttatggagccaaggactcacttatttacatcttcggggttcccataactgcactcttaatcaagcaatcagtaatgcctcgtgcagtttcgaatgactacttcattccaggagtcacttccgcaactgccttggtgctcgccaaacttaacaagatttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

159

Amino Acids

17.4

Weight (kDa)

7.75

Isoelectric Point (pI)

30.09

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015337)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G41200
fragaria_vesca	FvH4_6g45840 FvH4_6g45840
malus_domestica	MD14G1087900.v1.1
prunus_persica	Prupe.7G038600_v2.0.a1 Prupe.7G038600_v2.0.a1
pyrus_communis	pycom14g07800
rosa_chinensis	RchiOBHm_Chr2g0164041
rosa_laevigata	RLG00000021434
rosa_multiflora	Rmu_ssc0000432.1_g000009
rosa_roxburghii	Rroxscaffold_2G00086810
rosa_samantha	Rh2AG574500 Rh2BG585100 Rh2CG556000 Rh2DG594700
rosa_wichuraiana	Rw2G047520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	26
AccB1I	GGYRCC	1 cut(s)	26
AciI	CCGC	2 cut(s)	21, 441
AclWI	GGATC	1 cut(s)	320
AfaI	GTAC	1 cut(s)	28
AfiI	CCNNNNNNNGG	1 cut(s)	36
AhlI	ACTAGT	1 cut(s)	41
AjnI	CCWGG	1 cut(s)	427
AluBI	AGCT	2 cut(s)	119, 140
AluI	AGCT	2 cut(s)	119, 140
Alw21I	GWGCWC	1 cut(s)	459
AlwI	GGATC	1 cut(s)	320
AoxI	GGCC	1 cut(s)	78
Asp718I	GGTACC	1 cut(s)	26
AsuII	TTCGAA	1 cut(s)	410
BanI	GGYRCC	1 cut(s)	26
BauI	CACGAG	1 cut(s)	399
Bbv12I	GWGCWC	1 cut(s)	459
BccI	CCATC	1 cut(s)	177
BciT130I	CCWGG	1 cut(s)	429
BcuI	ACTAGT	1 cut(s)	41
BfaI	CTAG	1 cut(s)	42
BfmI	CTRYAG	1 cut(s)	133
Bme1390I	CCNGG	1 cut(s)	429
BmiI	GGNNCC	3 cut(s)	28, 328, 360
BmrFI	CCNGG	1 cut(s)	429
Bpu14I	TTCGAA	1 cut(s)	410
BpuEI	CTTGAG	1 cut(s)	200
BsaJI	CCNNGG	3 cut(s)	30, 330, 450
Bsc4I	CCNNNNNNNGG	1 cut(s)	36
Bse3DI	GCAATG	1 cut(s)	100
BseBI	CCWGG	1 cut(s)	429
BseDI	CCNNGG	3 cut(s)	30, 330, 450
BseLI	CCNNNNNNNGG	1 cut(s)	36
BseMI	GCAATG	1 cut(s)	100
BseMII	CTCAG	1 cut(s)	111
BseRI	GAGGAG	1 cut(s)	47
BsgI	GTGCAG	2 cut(s)	354, 423
BshFI	GGCC	1 cut(s)	80
BshNI	GGYRCC	1 cut(s)	26
BsiHKAI	GWGCWC	1 cut(s)	459
BslFI	GGGAC	1 cut(s)	262
BslI	CCNNNNNNNGG	1 cut(s)	36
BsmFI	GGGAC	1 cut(s)	262
BsnI	GGCC	1 cut(s)	80
Bsp119I	TTCGAA	1 cut(s)	410
Bsp1286I	GDGCHC	1 cut(s)	459
Bsp143I	GATC	1 cut(s)	312
BspACI	CCGC	2 cut(s)	21, 441
BspANI	GGCC	1 cut(s)	80
BspCNI	CTCAG	1 cut(s)	112
BspLI	GGNNCC	3 cut(s)	28, 328, 360
BspPI	GGATC	1 cut(s)	320
BspT104I	TTCGAA	1 cut(s)	410
BspT107I	GGYRCC	1 cut(s)	26
BsrDI	GCAATG	1 cut(s)	100
BssECI	CCNNGG	3 cut(s)	30, 330, 450
BssMI	GATC	1 cut(s)	312
BssSI	CACGAG	1 cut(s)	399
BssT1I	CCWWGG	2 cut(s)	330, 450
Bst2BI	CACGAG	1 cut(s)	399
Bst2UI	CCWGG	1 cut(s)	429
Bst6I	CTCTTC	1 cut(s)	264
BstBI	TTCGAA	1 cut(s)	410
BstC8I	GCNNGC	1 cut(s)	459
BstDEI	CTNAG	2 cut(s)	14, 120
BstKTI	GATC	1 cut(s)	315
BstMBI	GATC	1 cut(s)	312
BstMWI	GCNNNNNNNGC	1 cut(s)	230
BstNI	CCWGG	1 cut(s)	429
BstSCI	CCNGG	1 cut(s)	427
BstSFI	CTRYAG	1 cut(s)	133
BsuRI	GGCC	1 cut(s)	80
BtsIMutI	CAGTG	1 cut(s)	322
Cac8I	GCNNGC	1 cut(s)	459
Csp6I	GTAC	1 cut(s)	27
CviJI	RGCY	5 cut(s)	80, 119, 140, 233, 329
CviKI_1	RGCY	5 cut(s)	80, 119, 140, 233, 329
CviQI	GTAC	1 cut(s)	27
DdeI	CTNAG	2 cut(s)	14, 120
DpnI	GATC	1 cut(s)	314
DpnII	GATC	1 cut(s)	312
Eam1104I	CTCTTC	1 cut(s)	264
EarI	CTCTTC	1 cut(s)	264
Eco130I	CCWWGG	2 cut(s)	330, 450
EcoRII	CCWGG	1 cut(s)	427
EcoT14I	CCWWGG	2 cut(s)	330, 450
ErhI	CCWWGG	2 cut(s)	330, 450
FaiI	YATR	7 cut(s)	59, 116, 143, 145, 177, 324, 365
FaqI	GGGAC	1 cut(s)	262
FauI	CCCGC	1 cut(s)	14
FspBI	CTAG	1 cut(s)	42
HaeIII	GGCC	1 cut(s)	80
HinfI	GANTC	3 cut(s)	98, 335, 432
Hpy188I	TCNGA	1 cut(s)	278
Hpy99I	CGWCG	1 cut(s)	158
HpyAV	CCTTC	1 cut(s)	239
HpyCH4IV	ACGT	1 cut(s)	195
HpyCH4V	TGCA	3 cut(s)	289, 371, 404
HpyF10VI	GCNNNNNNNGC	1 cut(s)	230
HpyF3I	CTNAG	2 cut(s)	14, 120
HpySE526I	ACGT	1 cut(s)	195
KpnI	GGTACC	1 cut(s)	30
Kzo9I	GATC	1 cut(s)	312
LmnI	GCTCC	1 cut(s)	326
LpnPI	CCDG	4 cut(s)	237, 294, 414, 441
MaeI	CTAG	1 cut(s)	42
MaeII	ACGT	1 cut(s)	195
MaeIII	GTNAC	1 cut(s)	433
MalI	GATC	1 cut(s)	314
MboI	GATC	1 cut(s)	312
MboII	GAAGA	3 cut(s)	281, 291, 343
MhlI	GDGCHC	1 cut(s)	459
MluCI	AATT	2 cut(s)	189, 257
MlyI	GAGTC	2 cut(s)	329, 441
MnlI	CCTC	5 cut(s)	11, 25, 30, 70, 408
MseI	TTAA	5 cut(s)	192, 228, 377, 468, 478
MspR9I	CCNGG	1 cut(s)	429
MvaI	CCWGG	1 cut(s)	429
MwoI	GCNNNNNNNGC	1 cut(s)	230
NdeII	GATC	1 cut(s)	312
NlaIV	GGNNCC	3 cut(s)	28, 328, 360
NmuCI	GTSAC	1 cut(s)	433
NspV	TTCGAA	1 cut(s)	410
PfeI	GAWTC	1 cut(s)	98
PfoI	TCCNGGA	1 cut(s)	427
PleI	GAGTC	2 cut(s)	329, 440
PpsI	GAGTC	2 cut(s)	329, 440
Psp6I	CCWGG	1 cut(s)	427
PspGI	CCWGG	1 cut(s)	427
PspN4I	GGNNCC	3 cut(s)	28, 328, 360
RsaI	GTAC	1 cut(s)	28
RsaNI	GTAC	1 cut(s)	27
SaqAI	TTAA	5 cut(s)	192, 228, 377, 468, 478
Sau3AI	GATC	1 cut(s)	312
SchI	GAGTC	2 cut(s)	329, 441
ScrFI	CCNGG	1 cut(s)	429
SduI	GDGCHC	1 cut(s)	459
SetI	ASST	3 cut(s)	121, 142, 198
SfcI	CTRYAG	1 cut(s)	133
SfuI	TTCGAA	1 cut(s)	410
SmlI	CTYRAG	1 cut(s)	215
SmoI	CTYRAG	1 cut(s)	215
SpeI	ACTAGT	1 cut(s)	41
Sse9I	AATT	2 cut(s)	189, 257
SsiI	CCGC	2 cut(s)	21, 441
SspMI	CTAG	1 cut(s)	42
StyD4I	CCNGG	1 cut(s)	427
StyI	CCWWGG	2 cut(s)	330, 450
TaiI	ACGT	1 cut(s)	198
TaqI	TCGA	2 cut(s)	156, 410
TasI	AATT	2 cut(s)	189, 257
TfiI	GAWTC	1 cut(s)	98
Tru1I	TTAA	5 cut(s)	192, 228, 377, 468, 478
Tru9I	TTAA	5 cut(s)	192, 228, 377, 468, 478
TscAI	CASTG	1 cut(s)	322
TseFI	GTSAC	1 cut(s)	433
Tsp45I	GTSAC	1 cut(s)	433
TspDTI	ATGAA	2 cut(s)	111, 412
TspGWI	ACGGA	1 cut(s)	218
TspRI	CASTG	1 cut(s)	322
XspI	CTAG	1 cut(s)	42

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.