Rmu_ssc0000454.1_g000026

Multiple chloroplast division site 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000454.1
OG0012484
Physical Location & Seq
Reverse (-)
108209 .. 110261
2053 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000454.1_g000026.1.cds

Sequence Viewer

Length: 1218 bp
atggcttccacttcgactctccaattccactccctttccttccagacctcaatttgggtctcaaagcaccaaacacctgcattggtactaaaggttagaccccaattcgggtccagtaacggtcggttcatctgggcacgacggctaaaacccactcacaggttcctacttagagccattgacggctcaggtgaaaaccctaatgcccataatgatgagaactacaagtataccataaacctcaaagacccagttgacaagttccacggaatgatcagctcagtctctcccattgttttcaatatagacctcaatttgggtctcaaagcaccaaacacctgcattggtactaaaggtagctctaatggtgaaaaccctaatgcccataatgatgagaactacaagtataccataaacctcaaagacccagttgacaagttccacggaatgatcagctcagtctctcccattgttttcaagatacgacaacgagtgggatcgaatttggcaattggtttatgtattgcaactgcatttttggtggttgctctgagagtattcatggtcaggaagtcgaagaacaaccgtcaaggctctgtagctgatcttgtcagacgtggtcagcttaggtccgatagaagaggcatttcgaagcctctcatgtacgatgacccattcaataatccattggttaaagttggtaagggaaattcgactatagagatgtgtggaaaggtttatcgccttgccccaattactcttacgaaagaggaacaagctatccatcgaaagaggaggtcgcgggcataccagtggaagagaccgacaatgttccttaaagaaggggattcgatacctgctgatgttgacccggatacaattaggtggattccttccaatcatccttttgcaaccactgccggtgacattgatgaagacttggcacagaccaatgtgtatcagaaacatggtgtaccgtatcgaattcaggctgagcatgaagcactgcagagagagcaaaaggagagcaggttagtgatggactctagcaacgctacagatcctgtgaaagcattcaagtcaggtcccaagtcacccgagcatggggaagaaaacctcatcagtaatgaaggtggtgactccaagccacccttatccgaacgtgccccaaattcctccagtagcatgtcatcctccgaggaaaggcataaaccctga

Protein Analysis

405

Amino Acids

45.3

Weight (kDa)

9.63

Isoelectric Point (pI)

40.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012484)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G20830 AT1G20830
fragaria_vesca FvH4_5g25940
malus_domestica MD06G1005200.v1.1
prunus_persica Prupe.5G006400_v2.0.a1 Prupe.5G006400_v2.0.a1 Prupe.5G006400_v2.0.a1
pyrus_communis pycom06g00490
rosa_chinensis RchiOBHm_Chr4g0410601 RchiOBHm_Chr7g0216471
rosa_laevigata RLG00000002568
rosa_multiflora Rmu_ssc0000454.1_g000026
rosa_roxburghii Rroxscaffold_3G00243210
rosa_rugosa Rorug07G0160500
rosa_samantha Rh4CG174600 Rh7AG299700 Rh7BG291200 Rh7DG301000
rosa_wichuraiana Rw7G025470

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 2 cut(s) 85, 347
Acc36I ACCTGC 4 cut(s) 85, 347, 865, 1020
AccI GTMKAC 2 cut(s) 230, 407
AccII CGCG 1 cut(s) 802
AciI CCGC 1 cut(s) 802
AclWI GGATC 2 cut(s) 505, 1055
AcsI RAATTY 4 cut(s) 502, 709, 984, 1171
AfaI GTAC 4 cut(s) 87, 349, 665, 975
AfiI CCNNNNNNNGG 8 cut(s) 54, 107, 108, 159, 316, 1103, 1104, 1203
AgsI TTSAA 4 cut(s) 301, 478, 679, 1078
AjiI CACGTC 1 cut(s) 617
AloI GAACNNNNNNTCC 2 cut(s) 765, 797
AluBI AGCT 6 cut(s) 279, 360, 456, 602, 625, 779
AluI AGCT 6 cut(s) 279, 360, 456, 602, 625, 779
Alw26I GTCTC 5 cut(s) 64, 289, 326, 466, 814
AlwI GGATC 2 cut(s) 505, 1055
AlwNI CAGNNNCTG 1 cut(s) 1064
Ama87I CYCGRG 1 cut(s) 1097
ApoI RAATTY 4 cut(s) 502, 709, 984, 1171
Asp700I GAANNNNTTC 1 cut(s) 1073
AspS9I GGNCC 3 cut(s) 111, 630, 1085
AsuC2I CCSGG 1 cut(s) 872
AsuHPI GGTGA 5 cut(s) 203, 380, 935, 1086, 1148
AsuII TTCGAA 1 cut(s) 650
AvaI CYCGRG 1 cut(s) 1097
AvaII GGWCC 3 cut(s) 111, 630, 1085
BaeGI GKGCMC 2 cut(s) 139, 1168
BbsI GAAGAC 1 cut(s) 942
BccI CCATC 2 cut(s) 792, 1033
BceAI ACGGC 2 cut(s) 158, 199
BciVI GTATCC 1 cut(s) 868
BclI TGATCA 2 cut(s) 273, 450
BcnI CCSGG 1 cut(s) 872
BcoDI GTCTC 5 cut(s) 64, 289, 326, 466, 814
BfaI CTAG 1 cut(s) 1047
BfmI CTRYAG 4 cut(s) 597, 717, 1007, 1056
BfuAI ACCTGC 4 cut(s) 85, 347, 865, 1020
BfuI GTATCC 1 cut(s) 868
BlpI GCTNAGC 1 cut(s) 993
Bme1390I CCNGG 1 cut(s) 872
Bme18I GGWCC 3 cut(s) 111, 630, 1085
BmeT110I CYCGRG 1 cut(s) 1097
BmgBI CACGTC 1 cut(s) 617
BmgT120I GGNCC 3 cut(s) 111, 630, 1085
BmiI GGNNCC 3 cut(s) 112, 164, 1087
BmrFI CCNGG 1 cut(s) 872
BmrI ACTGGG 2 cut(s) 245, 422
BmuI ACTGGG 2 cut(s) 245, 422
BpiI GAAGAC 1 cut(s) 942
BpmI CTGGAG 1 cut(s) 1162
Bpu10I CCTNAGC 2 cut(s) 187, 626
Bpu1102I GCTNAGC 1 cut(s) 993
Bpu14I TTCGAA 1 cut(s) 650
BpuMI CCSGG 1 cut(s) 872
BsaI GGTCTC 3 cut(s) 64, 326, 814
BsaJI CCNNGG 3 cut(s) 265, 442, 1197
BsaXI ACNNNNNCTCC 2 cut(s) 1016, 1046
Bsc4I CCNNNNNNNGG 8 cut(s) 54, 107, 108, 159, 316, 1103, 1104, 1203
Bse118I RCCGGY 1 cut(s) 920
Bse1I ACTGG 5 cut(s) 114, 251, 428, 811, 1179
BseDI CCNNGG 3 cut(s) 265, 442, 1197
BseGI GGATG 2 cut(s) 901, 1190
BseLI CCNNNNNNNGG 8 cut(s) 54, 107, 108, 159, 316, 1103, 1104, 1203
BseMII CTCAG 5 cut(s) 201, 294, 471, 542, 984
BseNI ACTGG 5 cut(s) 114, 251, 428, 811, 1179
BseRI GAGGAG 1 cut(s) 808
BseSI GKGCMC 2 cut(s) 139, 1168
Bsh1236I CGCG 1 cut(s) 802
Bsh1285I CGRYCG 1 cut(s) 124
BsiEI CGRYCG 1 cut(s) 124
BsiHKCI CYCGRG 1 cut(s) 1097
BsiSI CCGG 2 cut(s) 872, 921
BslFI GGGAC 1 cut(s) 1071
BslI CCNNNNNNNGG 8 cut(s) 54, 107, 108, 159, 316, 1103, 1104, 1203
BsmAI GTCTC 5 cut(s) 64, 289, 326, 466, 814
BsmFI GGGAC 1 cut(s) 1071
BsmI GAATGC 1 cut(s) 1073
Bso31I GGTCTC 3 cut(s) 64, 326, 814
BsoBI CYCGRG 1 cut(s) 1097
Bsp119I TTCGAA 1 cut(s) 650
Bsp1286I GDGCHC 2 cut(s) 139, 1168
Bsp143I GATC 5 cut(s) 273, 450, 497, 604, 1060
Bsp1720I GCTNAGC 1 cut(s) 993
BspACI CCGC 1 cut(s) 802
BspCNI CTCAG 5 cut(s) 200, 293, 470, 543, 985
BspFNI CGCG 1 cut(s) 802
BspLI GGNNCC 3 cut(s) 112, 164, 1087
BspMAI CTGCAG 1 cut(s) 1011
BspMI ACCTGC 4 cut(s) 85, 347, 865, 1020
BspPI GGATC 2 cut(s) 505, 1055
BspT104I TTCGAA 1 cut(s) 650
BspTNI GGTCTC 3 cut(s) 64, 326, 814
BsrFI RCCGGY 1 cut(s) 920
BsrI ACTGG 5 cut(s) 114, 251, 428, 811, 1179
BssAI RCCGGY 1 cut(s) 920
BssECI CCNNGG 3 cut(s) 265, 442, 1197
BssMI GATC 5 cut(s) 273, 450, 497, 604, 1060
BssNAI GTATAC 2 cut(s) 231, 408
Bst1107I GTATAC 2 cut(s) 231, 408
Bst4CI ACNGT 3 cut(s) 122, 587, 978
Bst6I CTCTTC 2 cut(s) 634, 812
BstAPI GCANNNNNTGC 1 cut(s) 917
BstBI TTCGAA 1 cut(s) 650
BstC8I GCNNGC 1 cut(s) 804
BstDEI CTNAG 7 cut(s) 170, 187, 280, 457, 551, 626, 993
BstDSI CCRYGG 2 cut(s) 265, 442
BstF5I GGATG 2 cut(s) 901, 1190
BstFNI CGCG 1 cut(s) 802
BstKTI GATC 5 cut(s) 276, 453, 500, 607, 1063
BstMAI GTCTC 5 cut(s) 64, 289, 326, 466, 814
BstMBI GATC 5 cut(s) 273, 450, 497, 604, 1060
BstMCI CGRYCG 1 cut(s) 124
BstMWI GCNNNNNNNGC 2 cut(s) 917, 1015
BstNSI RCATGY 1 cut(s) 1189
BstSCI CCNGG 1 cut(s) 870
BstSFI CTRYAG 4 cut(s) 597, 717, 1007, 1056
BstSLI GKGCMC 2 cut(s) 139, 1168
BstUI CGCG 1 cut(s) 802
BstV2I GAAGAC 1 cut(s) 942
BstX2I RGATCY 1 cut(s) 1060
BstYI RGATCY 1 cut(s) 1060
BstZ17I GTATAC 2 cut(s) 231, 408
BsuI GTATCC 1 cut(s) 868
BtgI CCRYGG 2 cut(s) 265, 442
BtrI CACGTC 1 cut(s) 617
BtsCI GGATG 2 cut(s) 901, 1190
BtsI GCAGTG 2 cut(s) 915, 1004
BtsIMutI CAGTG 3 cut(s) 818, 915, 1004
BveI ACCTGC 4 cut(s) 85, 347, 865, 1020
Cac8I GCNNGC 1 cut(s) 804
CaiI CAGNNNCTG 1 cut(s) 1064
Cfr10I RCCGGY 1 cut(s) 920
Cfr13I GGNCC 3 cut(s) 111, 630, 1085
Csp6I GTAC 4 cut(s) 86, 348, 664, 974
CviAII CATG 6 cut(s) 562, 661, 968, 998, 1103, 1186
CviQI GTAC 4 cut(s) 86, 348, 664, 974
DdeI CTNAG 7 cut(s) 170, 187, 280, 457, 551, 626, 993
DpnI GATC 5 cut(s) 275, 452, 499, 606, 1062
DpnII GATC 5 cut(s) 273, 450, 497, 604, 1060
Eam1104I CTCTTC 2 cut(s) 634, 812
EarI CTCTTC 2 cut(s) 634, 812
Eco31I GGTCTC 3 cut(s) 64, 326, 814
Eco47I GGWCC 3 cut(s) 111, 630, 1085
Eco88I CYCGRG 1 cut(s) 1097
EcoO109I RGGNCCY 1 cut(s) 1085
EcoRI GAATTC 1 cut(s) 984
FaeI CATG 6 cut(s) 565, 664, 971, 1001, 1106, 1189
FalI AAGNNNNNCTT 2 cut(s) 1136, 1168
FaqI GGGAC 1 cut(s) 1071
FatI CATG 6 cut(s) 561, 660, 967, 997, 1102, 1185
FauI CCCGC 1 cut(s) 795
FbaI TGATCA 2 cut(s) 273, 450
FblI GTMKAC 2 cut(s) 230, 407
FokI GGATG 2 cut(s) 888, 1177
FspBI CTAG 1 cut(s) 1047
GsuI CTGGAG 1 cut(s) 1162
HapII CCGG 2 cut(s) 872, 921
Hin1II CATG 6 cut(s) 565, 664, 971, 1001, 1106, 1189
HincII GTYRAC 3 cut(s) 256, 433, 868
HindII GTYRAC 3 cut(s) 256, 433, 868
HinfI GANTC 5 cut(s) 16, 848, 889, 1043, 1139
HpaII CCGG 2 cut(s) 872, 921
HphI GGTGA 5 cut(s) 203, 380, 935, 1086, 1148
Hpy166II GTNNAC 6 cut(s) 231, 256, 408, 433, 868, 974
Hpy188I TCNGA 6 cut(s) 552, 614, 634, 963, 1159, 1198
Hpy188III TCNNGA 3 cut(s) 43, 478, 568
Hpy8I GTNNAC 6 cut(s) 231, 256, 408, 433, 868, 974
Hpy99I CGWCG 1 cut(s) 144
HpyAV CCTTC 4 cut(s) 49, 836, 903, 1124
HpyCH4III ACNGT 3 cut(s) 122, 587, 978
HpyCH4IV ACGT 2 cut(s) 616, 1162
HpyCH4V TGCA 6 cut(s) 80, 342, 527, 533, 911, 1009
HpyF10VI GCNNNNNNNGC 2 cut(s) 917, 1015
HpyF3I CTNAG 7 cut(s) 170, 187, 280, 457, 551, 626, 993
HpySE526I ACGT 2 cut(s) 616, 1162
Hsp92II CATG 6 cut(s) 565, 664, 971, 1001, 1106, 1189
Ksp22I TGATCA 2 cut(s) 273, 450
Kzo9I GATC 5 cut(s) 273, 450, 497, 604, 1060
MaeI CTAG 1 cut(s) 1047
MaeII ACGT 2 cut(s) 616, 1162
MaeIII GTNAC 4 cut(s) 116, 923, 1092, 1136
MalI GATC 5 cut(s) 275, 452, 499, 606, 1062
MboI GATC 5 cut(s) 273, 450, 497, 604, 1060
MboII GAAGA 5 cut(s) 589, 651, 829, 947, 1121
MfeI CAATTG 1 cut(s) 510
MflI RGATCY 1 cut(s) 1060
MhlI GDGCHC 2 cut(s) 139, 1168
MlyI GAGTC 3 cut(s) 10, 1037, 1133
MroXI GAANNNNTTC 1 cut(s) 1073
MseI TTAA 2 cut(s) 693, 837
MslI CAYNNNNRTG 3 cut(s) 213, 390, 811
MspI CCGG 2 cut(s) 872, 921
MspR9I CCNGG 1 cut(s) 872
MunI CAATTG 1 cut(s) 510
Mva1269I GAATGC 1 cut(s) 1073
MvnI CGCG 1 cut(s) 802
MwoI GCNNNNNNNGC 2 cut(s) 917, 1015
NciI CCSGG 1 cut(s) 872
NdeII GATC 5 cut(s) 273, 450, 497, 604, 1060
NlaIII CATG 6 cut(s) 565, 664, 971, 1001, 1106, 1189
NlaIV GGNNCC 3 cut(s) 112, 164, 1087
NmuCI GTSAC 3 cut(s) 923, 1092, 1136
NspI RCATGY 1 cut(s) 1189
NspV TTCGAA 1 cut(s) 650
PaqCI CACCTGC 2 cut(s) 85, 347
PctI GAATGC 1 cut(s) 1073
PdmI GAANNNNTTC 1 cut(s) 1073
PfeI GAWTC 2 cut(s) 848, 889
PflFI GACNNNGTC 1 cut(s) 618
PleI GAGTC 3 cut(s) 10, 1037, 1133
PpsI GAGTC 3 cut(s) 10, 1037, 1133
PpuMI RGGWCCY 1 cut(s) 1085
Psp5II RGGWCCY 1 cut(s) 1085
PspN4I GGNNCC 3 cut(s) 112, 164, 1087
PspPI GGNCC 3 cut(s) 111, 630, 1085
PspPPI RGGWCCY 1 cut(s) 1085
PstI CTGCAG 1 cut(s) 1011
PstNI CAGNNNCTG 1 cut(s) 1064
PsuI RGATCY 1 cut(s) 1060
PsyI GACNNNGTC 1 cut(s) 618
RsaI GTAC 4 cut(s) 87, 349, 665, 975
RsaNI GTAC 4 cut(s) 86, 348, 664, 974
RseI CAYNNNNRTG 3 cut(s) 213, 390, 811
SaqAI TTAA 2 cut(s) 693, 837
Sau3AI GATC 5 cut(s) 273, 450, 497, 604, 1060
Sau96I GGNCC 3 cut(s) 111, 630, 1085
SchI GAGTC 3 cut(s) 10, 1037, 1133
ScrFI CCNGG 1 cut(s) 872
SduI GDGCHC 2 cut(s) 139, 1168
SfcI CTRYAG 4 cut(s) 597, 717, 1007, 1056
SfuI TTCGAA 1 cut(s) 650
SinI GGWCC 3 cut(s) 111, 630, 1085
SmiMI CAYNNNNRTG 3 cut(s) 213, 390, 811
SsiI CCGC 1 cut(s) 802
SspMI CTAG 1 cut(s) 1047
StyD4I CCNGG 1 cut(s) 870
TaaI ACNGT 3 cut(s) 122, 587, 978
TaiI ACGT 2 cut(s) 619, 1165
TaqI TCGA 8 cut(s) 14, 500, 575, 650, 713, 787, 851, 982
TaqII GACCGA 1 cut(s) 838
TfiI GAWTC 2 cut(s) 848, 889
Tru1I TTAA 2 cut(s) 693, 837
Tru9I TTAA 2 cut(s) 693, 837
TscAI CASTG 3 cut(s) 818, 922, 1011
TseFI GTSAC 3 cut(s) 923, 1092, 1136
Tsp45I GTSAC 3 cut(s) 923, 1092, 1136
TspDTI ATGAA 5 cut(s) 118, 550, 948, 1014, 1143
TspGWI ACGGA 2 cut(s) 282, 459
TspRI CASTG 3 cut(s) 818, 922, 1011
Tth111I GACNNNGTC 1 cut(s) 618
VpaK11BI GGWCC 3 cut(s) 111, 630, 1085
XapI RAATTY 4 cut(s) 502, 709, 984, 1171
XceI RCATGY 1 cut(s) 1189
XmiI GTMKAC 2 cut(s) 230, 407
XmnI GAANNNNTTC 1 cut(s) 1073
XspI CTAG 1 cut(s) 1047
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.