Rroxscaffold_1G00025180

Integral membrane protein TerC family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
31596340 .. 31599195
2856 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00025180.1

Sequence Viewer

Length: 186 bp
ATGGGCGGGGCTTCCGTCATCAACAACGGCATTCACATTCCCCTGAAATTCAACTCAGACCTTCCTAGGGTTTCATCACGATCCCCAGCCCCAAAATGGAGTAGGCCTCACTATATTCACCGTCTTGTTCTTCGCCACTGCACATGTGGTGGCCATGGTCGACAGTCTGTCAATTGTGTGTTCTAG

Protein Analysis

61

Amino Acids

6.76

Weight (kDa)

10.86

Isoelectric Point (pI)

79.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 160
AciI CCGC 1 cut(s) 6
AclWI GGATC 1 cut(s) 75
AcoI YGGCCR 1 cut(s) 151
AcsI RAATTY 1 cut(s) 47
AfiI CCNNNNNNNGG 2 cut(s) 67, 96
AflIII ACRYGT 1 cut(s) 143
AgsI TTSAA 1 cut(s) 52
AhdI GACNNNNNGTC 1 cut(s) 167
AlwI GGATC 1 cut(s) 75
AoxI GGCC 2 cut(s) 104, 151
ApoI RAATTY 1 cut(s) 47
AspA2I CCTAGG 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 110
AvrII CCTAGG 1 cut(s) 65
BalI TGGCCA 1 cut(s) 153
BceAI ACGGC 1 cut(s) 43
BfaI CTAG 2 cut(s) 66, 184
BlnI CCTAGG 1 cut(s) 65
BmeRI GACNNNNNGTC 1 cut(s) 167
BplI GAGNNNNNCTC 2 cut(s) 91, 123
BsaJI CCNNGG 2 cut(s) 65, 154
Bsc4I CCNNNNNNNGG 2 cut(s) 67, 96
BseDI CCNNGG 2 cut(s) 65, 154
BseLI CCNNNNNNNGG 2 cut(s) 67, 96
BseMII CTCAG 1 cut(s) 69
BseYI CCCAGC 1 cut(s) 85
BsgI GTGCAG 1 cut(s) 124
BshFI GGCC 2 cut(s) 106, 153
BslI CCNNNNNNNGG 2 cut(s) 67, 96
BsmI GAATGC 1 cut(s) 30
BsnI GGCC 2 cut(s) 106, 153
Bsp143I GATC 1 cut(s) 80
Bsp19I CCATGG 1 cut(s) 154
BspACI CCGC 1 cut(s) 6
BspANI GGCC 2 cut(s) 106, 153
BspCNI CTCAG 1 cut(s) 68
BspPI GGATC 1 cut(s) 75
BssECI CCNNGG 2 cut(s) 65, 154
BssMI GATC 1 cut(s) 80
BssT1I CCWWGG 2 cut(s) 65, 154
Bst4CI ACNGT 2 cut(s) 122, 165
BstDEI CTNAG 1 cut(s) 55
BstDSI CCRYGG 1 cut(s) 154
BstKTI GATC 1 cut(s) 83
BstMBI GATC 1 cut(s) 80
BstNSI RCATGY 1 cut(s) 147
BsuRI GGCC 2 cut(s) 106, 153
BtgI CCRYGG 1 cut(s) 154
BtsI GCAGTG 1 cut(s) 136
BtsIMutI CAGTG 1 cut(s) 136
CviAII CATG 2 cut(s) 144, 155
CviJI RGCY 4 cut(s) 11, 89, 106, 153
CviKI_1 RGCY 4 cut(s) 11, 89, 106, 153
DdeI CTNAG 1 cut(s) 55
DpnI GATC 1 cut(s) 82
DpnII GATC 1 cut(s) 80
DriI GACNNNNNGTC 1 cut(s) 167
EaeI YGGCCR 1 cut(s) 151
Eam1105I GACNNNNNGTC 1 cut(s) 167
Eco130I CCWWGG 2 cut(s) 65, 154
Eco147I AGGCCT 1 cut(s) 106
EcoT14I CCWWGG 2 cut(s) 65, 154
ErhI CCWWGG 2 cut(s) 65, 154
FaeI CATG 2 cut(s) 147, 158
FaiI YATR 3 cut(s) 114, 145, 156
FatI CATG 2 cut(s) 143, 154
FblI GTMKAC 1 cut(s) 160
FspBI CTAG 2 cut(s) 66, 184
GsaI CCCAGC 1 cut(s) 89
HaeIII GGCC 2 cut(s) 106, 153
Hin1II CATG 2 cut(s) 147, 158
HincII GTYRAC 1 cut(s) 161
HindII GTYRAC 1 cut(s) 161
HphI GGTGA 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 161
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 78
Hpy8I GTNNAC 1 cut(s) 161
HpyAV CCTTC 1 cut(s) 71
HpyCH4III ACNGT 2 cut(s) 122, 165
HpyCH4V TGCA 1 cut(s) 141
HpyF3I CTNAG 1 cut(s) 55
Hsp92II CATG 2 cut(s) 147, 158
Kzo9I GATC 1 cut(s) 80
LpnPI CCDG 2 cut(s) 56, 99
MaeI CTAG 2 cut(s) 66, 184
MalI GATC 1 cut(s) 82
MboI GATC 1 cut(s) 80
MboII GAAGA 1 cut(s) 122
MfeI CAATTG 1 cut(s) 172
MlsI TGGCCA 1 cut(s) 153
MluCI AATT 2 cut(s) 47, 172
MluNI TGGCCA 1 cut(s) 153
MnlI CCTC 1 cut(s) 117
Mox20I TGGCCA 1 cut(s) 153
MscI TGGCCA 1 cut(s) 153
Msp20I TGGCCA 1 cut(s) 153
MunI CAATTG 1 cut(s) 172
Mva1269I GAATGC 1 cut(s) 30
NcoI CCATGG 1 cut(s) 154
NdeII GATC 1 cut(s) 80
NlaIII CATG 2 cut(s) 147, 158
NspI RCATGY 1 cut(s) 147
PceI AGGCCT 1 cut(s) 106
PciI ACATGT 1 cut(s) 143
PctI GAATGC 1 cut(s) 30
PscI ACATGT 1 cut(s) 143
PspFI CCCAGC 1 cut(s) 85
SalI GTCGAC 1 cut(s) 159
Sau3AI GATC 1 cut(s) 80
SetI ASST 1 cut(s) 63
SgeI CNNG 8 cut(s) 19, 55, 78, 90, 98, 137, 156, 167
Sse9I AATT 2 cut(s) 47, 172
SseBI AGGCCT 1 cut(s) 106
SsiI CCGC 1 cut(s) 6
SspMI CTAG 2 cut(s) 66, 184
StuI AGGCCT 1 cut(s) 106
StyI CCWWGG 2 cut(s) 65, 154
TaaI ACNGT 2 cut(s) 122, 165
TaqI TCGA 1 cut(s) 160
TasI AATT 2 cut(s) 47, 172
TscAI CASTG 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 63
TspGWI ACGGA 1 cut(s) 4
TspRI CASTG 1 cut(s) 143
XapI RAATTY 1 cut(s) 47
XceI RCATGY 1 cut(s) 147
XcmI CCANNNNNNNNNTGG 2 cut(s) 93, 143
XmaJI CCTAGG 1 cut(s) 65
XmiI GTMKAC 1 cut(s) 160
XspI CTAG 2 cut(s) 66, 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.