Rh6DG319200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
52189188 .. 52192730
3543 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG319200.1

Sequence Viewer

Length: 177 bp
ATGGTCGACAGTCTGCCAATTGTGTGTTCTAGAGCAACTGAGCAGGACGATGATGTATCCACTTCAGGCACTTGGTTCTACACGCTTCAATTGAAGTGGTACGCATATCGTTTTAAGGGAAAGCTCTCATGCATCAGCCTTCTCTGCACACATTTTCCAGGTCACTCATCTTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.65

Weight (kDa)

6.69

Isoelectric Point (pI)

40.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 6
AcuI CTGAAG 1 cut(s) 48
AfaI GTAC 1 cut(s) 101
AgsI TTSAA 2 cut(s) 89, 94
AjnI CCWGG 1 cut(s) 157
AjuI GAANNNNNNNTTGG 2 cut(s) 10, 42
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
BciT130I CCWGG 1 cut(s) 159
BciVI GTATCC 1 cut(s) 67
BfaI CTAG 1 cut(s) 30
BfuI GTATCC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 1 cut(s) 141
BseBI CCWGG 1 cut(s) 159
BseMII CTCAG 1 cut(s) 30
BsgI GTGCAG 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 31
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 39
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BsuI GTATCC 1 cut(s) 67
Csp6I GTAC 1 cut(s) 100
CspCI CAANNNNNGTGG 2 cut(s) 77, 112
CviAII CATG 1 cut(s) 129
CviJI RGCY 2 cut(s) 124, 138
CviKI_1 RGCY 2 cut(s) 124, 138
CviQI GTAC 1 cut(s) 100
DdeI CTNAG 1 cut(s) 39
Eco57I CTGAAG 1 cut(s) 48
EcoRII CCWGG 1 cut(s) 157
EcoT22I ATGCAT 1 cut(s) 134
FaeI CATG 1 cut(s) 132
FaiI YATR 2 cut(s) 106, 130
FatI CATG 1 cut(s) 128
FblI GTMKAC 1 cut(s) 6
FspBI CTAG 1 cut(s) 30
Hin1II CATG 1 cut(s) 132
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
Hpy166II GTNNAC 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 30
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 149
HpyCH4III ACNGT 1 cut(s) 11
HpyCH4V TGCA 2 cut(s) 132, 147
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 1 cut(s) 132
LpnPI CCDG 4 cut(s) 29, 51, 144, 171
LweI GCATC 1 cut(s) 141
MaeI CTAG 1 cut(s) 30
MaeIII GTNAC 1 cut(s) 161
MfeI CAATTG 2 cut(s) 18, 89
MluCI AATT 2 cut(s) 18, 89
Mph1103I ATGCAT 1 cut(s) 134
MseI TTAA 1 cut(s) 114
MspR9I CCNGG 1 cut(s) 159
MunI CAATTG 2 cut(s) 18, 89
MvaI CCWGG 1 cut(s) 159
MwoI GCNNNNNNNGC 1 cut(s) 144
NlaIII CATG 1 cut(s) 132
NmuCI GTSAC 1 cut(s) 161
NsiI ATGCAT 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
RsaI GTAC 1 cut(s) 101
RsaNI GTAC 1 cut(s) 100
SalI GTCGAC 1 cut(s) 5
SaqAI TTAA 1 cut(s) 114
ScrFI CCNGG 1 cut(s) 159
SetI ASST 2 cut(s) 126, 163
SfaNI GCATC 1 cut(s) 141
SgeI CNNG 8 cut(s) 42, 56, 78, 84, 94, 141, 170, 171
Sse9I AATT 2 cut(s) 18, 89
SspMI CTAG 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 11
TaqI TCGA 1 cut(s) 6
TasI AATT 2 cut(s) 18, 89
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseFI GTSAC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 161
XbaI TCTAGA 1 cut(s) 29
XmiI GTMKAC 1 cut(s) 6
XspI CTAG 1 cut(s) 30
Zsp2I ATGCAT 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.