Rroxscaffold_1G00041550

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
59430660 .. 59431010
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00041550.1

Sequence Viewer

Length: 351 bp
ATGGCAGCATTTGAGGCTCTGTGTCTAGCTAAGGAACTGGGTTGGCCACGAGTTTGCTTTGAGGGTGACTCCGTACGTGTTGTGAATGCTCTGCAAACTTCTACTACTTCTGATGAGTCCGACACTCCTTCTCCTCCTCCTCATTTGGTCAGATCATTAGTGCGATTCAATATATGTCACGCTGCTTTCCAGCAGACTACATTTTCTCTTGTTCACCAGAAGGCTAATGTTGTTGCTGAGAACCTTGCTACACATGCTTTATCAAACCCCGAAGAGAACCATTGGATTGCTAAGCCCCCTACTTTTATCGACTCCTCTTTGGCTATTGAAAAATATGCTTCTTCAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

12.71

Weight (kDa)

5.64

Isoelectric Point (pI)

56.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 2 - 86 1.1e-06 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 44
AfaI GTAC 1 cut(s) 75
AflIII ACRYGT 1 cut(s) 76
AgsI TTSAA 3 cut(s) 169, 329, 345
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
AoxI GGCC 1 cut(s) 44
ApeKI GCWGC 2 cut(s) 5, 182
AsuHPI GGTGA 2 cut(s) 77, 206
BalI TGGCCA 1 cut(s) 46
BauI CACGAG 1 cut(s) 48
BbvI GCAGC 2 cut(s) 17, 169
BfaI CTAG 1 cut(s) 26
BisI GCNGC 2 cut(s) 6, 183
BlpI GCTNAGC 1 cut(s) 291
BlsI GCNGC 2 cut(s) 7, 184
BmrI ACTGGG 1 cut(s) 47
BmuI ACTGGG 1 cut(s) 47
BplI GAGNNNNNCTC 2 cut(s) 53, 85
Bpu10I CCTNAGC 1 cut(s) 30
Bpu1102I GCTNAGC 1 cut(s) 291
BsaAI YACGTR 1 cut(s) 77
BsaXI ACNNNNNCTCC 2 cut(s) 115, 145
Bse1I ACTGG 1 cut(s) 42
BseMII CTCAG 1 cut(s) 228
BseNI ACTGG 1 cut(s) 42
BseRI GAGGAG 4 cut(s) 123, 126, 129, 304
BseXI GCAGC 2 cut(s) 17, 169
BshFI GGCC 1 cut(s) 46
BsiWI CGTACG 1 cut(s) 73
BsmI GAATGC 1 cut(s) 91
BsnI GGCC 1 cut(s) 46
Bsp143I GATC 1 cut(s) 152
Bsp1720I GCTNAGC 1 cut(s) 291
BspANI GGCC 1 cut(s) 46
BspCNI CTCAG 1 cut(s) 229
BsrI ACTGG 1 cut(s) 42
BssMI GATC 1 cut(s) 152
BssSI CACGAG 1 cut(s) 48
Bst2BI CACGAG 1 cut(s) 48
Bst6I CTCTTC 1 cut(s) 267
BstBAI YACGTR 1 cut(s) 77
BstDEI CTNAG 3 cut(s) 30, 237, 291
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstMWI GCNNNNNNNGC 2 cut(s) 14, 254
BstNSI RCATGY 1 cut(s) 257
BstV1I GCAGC 2 cut(s) 17, 169
BsuRI GGCC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 74
CviAII CATG 1 cut(s) 254
CviJI RGCY 6 cut(s) 17, 29, 46, 224, 295, 323
CviKI_1 RGCY 6 cut(s) 17, 29, 46, 224, 295, 323
CviQI GTAC 1 cut(s) 74
DdeI CTNAG 3 cut(s) 30, 237, 291
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
EaeI YGGCCR 1 cut(s) 44
Eam1104I CTCTTC 1 cut(s) 267
EarI CTCTTC 1 cut(s) 267
FaeI CATG 1 cut(s) 257
FaiI YATR 5 cut(s) 173, 175, 255, 336, 349
FatI CATG 1 cut(s) 253
Fnu4HI GCNGC 2 cut(s) 6, 183
Fsp4HI GCNGC 2 cut(s) 6, 183
FspBI CTAG 1 cut(s) 26
GluI GCNGC 2 cut(s) 6, 183
HaeIII GGCC 1 cut(s) 46
Hin1II CATG 1 cut(s) 257
HinfI GANTC 4 cut(s) 68, 116, 165, 311
HphI GGTGA 2 cut(s) 77, 206
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 3 cut(s) 112, 121, 152
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 2 cut(s) 138, 214
HpyCH4IV ACGT 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 94
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 254
HpyF3I CTNAG 3 cut(s) 30, 237, 291
HpySE526I ACGT 1 cut(s) 76
Hsp92II CATG 1 cut(s) 257
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 3 cut(s) 23, 203, 230
Lsp1109I GCAGC 2 cut(s) 17, 169
MaeI CTAG 1 cut(s) 26
MaeII ACGT 1 cut(s) 76
MaeIII GTNAC 2 cut(s) 65, 176
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 2 cut(s) 284, 333
MlsI TGGCCA 1 cut(s) 46
MluNI TGGCCA 1 cut(s) 46
MlyI GAGTC 3 cut(s) 62, 125, 305
MmeI TCCRAC 1 cut(s) 144
MnlI CCTC 6 cut(s) 7, 55, 144, 147, 150, 325
Mox20I TGGCCA 1 cut(s) 46
MscI TGGCCA 1 cut(s) 46
Msp20I TGGCCA 1 cut(s) 46
Mva1269I GAATGC 1 cut(s) 91
MwoI GCNNNNNNNGC 2 cut(s) 14, 254
NdeII GATC 1 cut(s) 152
NlaIII CATG 1 cut(s) 257
NmuCI GTSAC 2 cut(s) 65, 176
NspI RCATGY 1 cut(s) 257
PctI GAATGC 1 cut(s) 91
PfeI GAWTC 1 cut(s) 165
Pfl23II CGTACG 1 cut(s) 73
PkrI GCNGC 2 cut(s) 7, 184
PleI GAGTC 3 cut(s) 62, 124, 305
PpsI GAGTC 3 cut(s) 62, 124, 305
Ppu21I YACGTR 1 cut(s) 77
PspLI CGTACG 1 cut(s) 73
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
SatI GCNGC 2 cut(s) 6, 183
Sau3AI GATC 1 cut(s) 152
SchI GAGTC 3 cut(s) 62, 125, 305
SetI ASST 3 cut(s) 31, 79, 246
SspMI CTAG 1 cut(s) 26
TaiI ACGT 1 cut(s) 79
TaqI TCGA 1 cut(s) 309
TfiI GAWTC 1 cut(s) 165
TseFI GTSAC 2 cut(s) 65, 176
TseI GCWGC 2 cut(s) 5, 182
Tsp45I GTSAC 2 cut(s) 65, 176
TspGWI ACGGA 1 cut(s) 61
XceI RCATGY 1 cut(s) 257
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.