Rroxscaffold_2G00123440

Cell wall vacuolar inhibitor of fructosidase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
57273323 .. 57273874
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00123440.1

Sequence Viewer

Length: 552 bp
ATGGGATCTAGTACTACTTCTGCTACATTCTCCTTGGTTATTCTTCTACTACTACTTCTACAACATGATCATTTTGCGAGTGCAGACTCTAGCTTGATCCAGAAAACCTGCAAAGCCACCAAGTACTATTCCCTTTGCATGTCCTCCCTCAAGTCCGATCCCACCAGCCTAACCGCAGACGGCAAGGGCTTGGCAGCTATTATTGTCAGAATCGCGACCACCAATGCCACCGCAACCTCTTCTTACTTGTCCTCCCAAGTTCTCAGCTCTGCAAACGACGCCAACGCCAAGAAGGTGCTGAAGGAGTGTGCTGACAAGTATGGCTACGCCGGCGAGGCCCTGCAGGGTTCGCTGCAGGACCTGGCGGCGGAGTCTTATGACTATGCTTACATGCACATCACTGCAGCTGCCGACTACCCTAATGCTTGCCACAATGCGTTTAGAAGGTATCCAGCGTTGGCTTATCCACCGGGGCTTGCTAGAAGAGAGGATGCTTTGAAGCGGATTTGTGATGTGGTTTTGGGAATTCTTGATAGTCTTGGTTGGGATTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

19.59

Weight (kDa)

6.4

Isoelectric Point (pI)

59.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 31 - 175 1.6e-24 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012178)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 116
AccII CGCG 1 cut(s) 215
AciI CCGC 5 cut(s) 174, 231, 365, 368, 502
AclWI GGATC 3 cut(s) 13, 91, 152
AcsI RAATTY 1 cut(s) 525
AcuI CTGAAG 1 cut(s) 320
AcyI GRCGYC 1 cut(s) 279
AfaI GTAC 2 cut(s) 13, 125
AfiI CCNNNNNNNGG 1 cut(s) 367
AgsI TTSAA 1 cut(s) 499
AjnI CCWGG 1 cut(s) 360
AluBI AGCT 4 cut(s) 93, 197, 267, 407
AluI AGCT 4 cut(s) 93, 197, 267, 407
AlwI GGATC 3 cut(s) 13, 91, 152
AlwNI CAGNNNCTG 1 cut(s) 361
AoxI GGCC 1 cut(s) 336
ApeKI GCWGC 4 cut(s) 194, 352, 404, 407
ApoI RAATTY 1 cut(s) 525
AspS9I GGNCC 2 cut(s) 337, 358
AsuC2I CCSGG 1 cut(s) 471
AvaII GGWCC 1 cut(s) 358
BbvI GCAGC 4 cut(s) 206, 339, 394, 416
BceAI ACGGC 1 cut(s) 196
BciT130I CCWGG 1 cut(s) 362
BciVI GTATCC 1 cut(s) 459
BclI TGATCA 1 cut(s) 67
BcnI CCSGG 1 cut(s) 471
BfaI CTAG 3 cut(s) 9, 90, 480
BfmI CTRYAG 3 cut(s) 341, 353, 402
BfuAI ACCTGC 1 cut(s) 116
BfuI GTATCC 1 cut(s) 459
BglI GCCNNNNNGGC 1 cut(s) 335
BisI GCNGC 5 cut(s) 195, 353, 366, 405, 408
BlsI GCNGC 5 cut(s) 196, 354, 367, 406, 409
BmcAI AGTACT 2 cut(s) 13, 125
Bme1390I CCNGG 2 cut(s) 362, 471
Bme18I GGWCC 1 cut(s) 358
BmgT120I GGNCC 2 cut(s) 337, 358
BmrFI CCNGG 2 cut(s) 362, 471
BmsI GCATC 1 cut(s) 481
BpuEI CTTGAG 1 cut(s) 134
BpuMI CCSGG 1 cut(s) 471
BsaHI GRCGYC 1 cut(s) 279
BsaJI CCNNGG 2 cut(s) 33, 470
BsaXI ACNNNNNCTCC 2 cut(s) 236, 266
Bsc4I CCNNNNNNNGG 1 cut(s) 367
Bse118I RCCGGY 1 cut(s) 329
BseBI CCWGG 1 cut(s) 362
BseDI CCNNGG 2 cut(s) 33, 470
BseGI GGATG 1 cut(s) 496
BseLI CCNNNNNNNGG 1 cut(s) 367
BseMII CTCAG 1 cut(s) 277
BseXI GCAGC 4 cut(s) 206, 339, 394, 416
BsgI GTGCAG 1 cut(s) 102
Bsh1236I CGCG 1 cut(s) 215
BshFI GGCC 1 cut(s) 338
BsiSI CCGG 2 cut(s) 330, 470
BslI CCNNNNNNNGG 1 cut(s) 367
BsnI GGCC 1 cut(s) 338
Bsp143I GATC 4 cut(s) 5, 67, 96, 157
Bsp68I TCGCGA 1 cut(s) 215
BspACI CCGC 5 cut(s) 174, 231, 365, 368, 502
BspANI GGCC 1 cut(s) 338
BspCNI CTCAG 1 cut(s) 276
BspFNI CGCG 1 cut(s) 215
BspMAI CTGCAG 3 cut(s) 345, 357, 406
BspMI ACCTGC 1 cut(s) 116
BspPI GGATC 3 cut(s) 13, 91, 152
BsrFI RCCGGY 1 cut(s) 329
BssAI RCCGGY 1 cut(s) 329
BssECI CCNNGG 2 cut(s) 33, 470
BssMI GATC 4 cut(s) 5, 67, 96, 157
BssNI GRCGYC 1 cut(s) 279
BssT1I CCWWGG 1 cut(s) 33
Bst2UI CCWGG 1 cut(s) 362
Bst6I CTCTTC 2 cut(s) 244, 478
BstACI GRCGYC 1 cut(s) 279
BstC8I GCNNGC 3 cut(s) 331, 427, 477
BstDEI CTNAG 1 cut(s) 263
BstF5I GGATG 1 cut(s) 496
BstFNI CGCG 1 cut(s) 215
BstKTI GATC 4 cut(s) 8, 70, 99, 160
BstMBI GATC 4 cut(s) 5, 67, 96, 157
BstMWI GCNNNNNNNGC 4 cut(s) 278, 330, 335, 349
BstNI CCWGG 1 cut(s) 362
BstNSI RCATGY 2 cut(s) 142, 394
BstSCI CCNGG 2 cut(s) 360, 469
BstSFI CTRYAG 3 cut(s) 341, 353, 402
BstUI CGCG 1 cut(s) 215
BstV1I GCAGC 4 cut(s) 206, 339, 394, 416
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
BsuI GTATCC 1 cut(s) 459
BsuRI GGCC 1 cut(s) 338
BtsCI GGATG 1 cut(s) 496
BtsI GCAGTG 1 cut(s) 399
BtsIMutI CAGTG 1 cut(s) 399
BtuMI TCGCGA 1 cut(s) 215
BveI ACCTGC 1 cut(s) 116
Cac8I GCNNGC 3 cut(s) 331, 427, 477
CaiI CAGNNNCTG 1 cut(s) 361
Cfr10I RCCGGY 1 cut(s) 329
Cfr13I GGNCC 2 cut(s) 337, 358
CseI GACGC 1 cut(s) 287
Csp6I GTAC 2 cut(s) 12, 124
CviAII CATG 3 cut(s) 65, 139, 391
CviQI GTAC 2 cut(s) 12, 124
DdeI CTNAG 1 cut(s) 263
DpnI GATC 4 cut(s) 7, 69, 98, 159
DpnII GATC 4 cut(s) 5, 67, 96, 157
Eam1104I CTCTTC 2 cut(s) 244, 478
EarI CTCTTC 2 cut(s) 244, 478
EciI GGCGGA 1 cut(s) 383
Eco130I CCWWGG 1 cut(s) 33
Eco47I GGWCC 1 cut(s) 358
Eco57I CTGAAG 1 cut(s) 320
EcoO109I RGGNCCY 2 cut(s) 337, 358
EcoRI GAATTC 1 cut(s) 525
EcoRII CCWGG 1 cut(s) 360
EcoT14I CCWWGG 1 cut(s) 33
ErhI CCWWGG 1 cut(s) 33
FaeI CATG 3 cut(s) 68, 142, 394
FaiI YATR 6 cut(s) 66, 140, 321, 378, 384, 392
FatI CATG 3 cut(s) 64, 138, 390
FbaI TGATCA 1 cut(s) 67
Fnu4HI GCNGC 5 cut(s) 195, 353, 366, 405, 408
FokI GGATG 1 cut(s) 503
Fsp4HI GCNGC 5 cut(s) 195, 353, 366, 405, 408
FspBI CTAG 3 cut(s) 9, 90, 480
GluI GCNGC 5 cut(s) 195, 353, 366, 405, 408
HaeIII GGCC 1 cut(s) 338
HapII CCGG 2 cut(s) 330, 470
HgaI GACGC 1 cut(s) 287
Hin1I GRCGYC 1 cut(s) 279
Hin1II CATG 3 cut(s) 68, 142, 394
HinfI GANTC 3 cut(s) 86, 210, 371
HpaII CCGG 2 cut(s) 330, 470
Hpy188I TCNGA 2 cut(s) 157, 209
Hpy188III TCNNGA 3 cut(s) 100, 214, 530
Hpy99I CGWCG 1 cut(s) 281
HpyAV CCTTC 3 cut(s) 286, 295, 438
HpyCH4V TGCA 8 cut(s) 83, 111, 138, 272, 343, 355, 394, 404
HpyF10VI GCNNNNNNNGC 4 cut(s) 278, 330, 335, 349
HpyF3I CTNAG 1 cut(s) 263
Hsp92I GRCGYC 1 cut(s) 279
Hsp92II CATG 3 cut(s) 68, 142, 394
KroI GCCGGC 1 cut(s) 329
KroNI GCCGGC 1 cut(s) 331
Ksp22I TGATCA 1 cut(s) 67
Kzo9I GATC 4 cut(s) 5, 67, 96, 157
Lsp1109I GCAGC 4 cut(s) 206, 339, 394, 416
LweI GCATC 1 cut(s) 481
MaeI CTAG 3 cut(s) 9, 90, 480
MalI GATC 4 cut(s) 7, 69, 98, 159
MboI GATC 4 cut(s) 5, 67, 96, 157
MboII GAAGA 3 cut(s) 35, 231, 495
MflI RGATCY 1 cut(s) 5
MluCI AATT 1 cut(s) 525
MlyI GAGTC 2 cut(s) 80, 380
MnlI CCTC 6 cut(s) 154, 158, 247, 262, 328, 481
MreI CGCCGGCG 1 cut(s) 329
MroNI GCCGGC 1 cut(s) 329
MspA1I CMGCKG 1 cut(s) 407
MspI CCGG 2 cut(s) 330, 470
MspR9I CCNGG 2 cut(s) 362, 471
MvaI CCWGG 1 cut(s) 362
MvnI CGCG 1 cut(s) 215
MwoI GCNNNNNNNGC 4 cut(s) 278, 330, 335, 349
NaeI GCCGGC 1 cut(s) 331
NciI CCSGG 1 cut(s) 471
NdeII GATC 4 cut(s) 5, 67, 96, 157
NgoMIV GCCGGC 1 cut(s) 329
NlaIII CATG 3 cut(s) 68, 142, 394
NruI TCGCGA 1 cut(s) 215
NspI RCATGY 2 cut(s) 142, 394
PdiI GCCGGC 1 cut(s) 331
PfeI GAWTC 1 cut(s) 210
PkrI GCNGC 5 cut(s) 196, 354, 367, 406, 409
PleI GAGTC 2 cut(s) 80, 379
PpsI GAGTC 2 cut(s) 80, 379
PpuMI RGGWCCY 1 cut(s) 358
Psp5II RGGWCCY 1 cut(s) 358
Psp6I CCWGG 1 cut(s) 360
PspGI CCWGG 1 cut(s) 360
PspPI GGNCC 2 cut(s) 337, 358
PspPPI RGGWCCY 1 cut(s) 358
PstI CTGCAG 3 cut(s) 345, 357, 406
PstNI CAGNNNCTG 1 cut(s) 361
PsuI RGATCY 1 cut(s) 5
PvuII CAGCTG 1 cut(s) 407
RruI TCGCGA 1 cut(s) 215
RsaI GTAC 2 cut(s) 13, 125
RsaNI GTAC 2 cut(s) 12, 124
SatI GCNGC 5 cut(s) 195, 353, 366, 405, 408
Sau3AI GATC 4 cut(s) 5, 67, 96, 157
Sau96I GGNCC 2 cut(s) 337, 358
SbfI CCTGCAGG 1 cut(s) 345
ScaI AGTACT 2 cut(s) 13, 125
SchI GAGTC 2 cut(s) 80, 380
ScrFI CCNGG 2 cut(s) 362, 471
SdaI CCTGCAGG 1 cut(s) 345
SetI ASST 9 cut(s) 95, 110, 199, 239, 269, 297, 363, 409, 449
SfaNI GCATC 1 cut(s) 481
SfcI CTRYAG 3 cut(s) 341, 353, 402
SgrAI CRCCGGYG 1 cut(s) 329
SinI GGWCC 1 cut(s) 358
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
Sse8387I CCTGCAGG 1 cut(s) 345
Sse9I AATT 1 cut(s) 525
SsiI CCGC 5 cut(s) 174, 231, 365, 368, 502
SspMI CTAG 3 cut(s) 9, 90, 480
StyD4I CCNGG 2 cut(s) 360, 469
StyI CCWWGG 1 cut(s) 33
TasI AATT 1 cut(s) 525
TatI WGTACW 2 cut(s) 11, 123
TauI GCSGC 1 cut(s) 368
TfiI GAWTC 1 cut(s) 210
TscAI CASTG 1 cut(s) 406
TseI GCWGC 4 cut(s) 194, 352, 404, 407
TspRI CASTG 1 cut(s) 406
VpaK11BI GGWCC 1 cut(s) 358
XapI RAATTY 1 cut(s) 525
XceI RCATGY 2 cut(s) 142, 394
XspI CTAG 3 cut(s) 9, 90, 480
ZrmI AGTACT 2 cut(s) 13, 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.