Rroxscaffold_2G00151810

Belongs to the GRAS family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
88965499 .. 88968399
2901 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00151810.1

Sequence Viewer

Length: 420 bp
ATGGAGCCGTACGGCAATTCCGGCGGCGTCAGCAGCAGCGCCAGCTCCTCTTCCTCCTCCTCTGCCGCCTCCATAACCAAGCCGCATGAGATGGACGGGTATTTGGCCGAGGCCGGGTACAAGGTCCGCTCCTCCGACCTACGACACGTCGCTCAGCGCCTCGAGCGCTTGGAAAACGTCATGGTCAACTCCCCCAACGACCTCGCCCACTTCGCCTCCGACGCCGTCATCTACAACCCCTCCGACCTCGCCTCCTGGGTCGACTCCTCCTCTCCGCCTCCGACCTCTCCATCTCCGATCTCGACTTCCCTGGCGTCATCATCAACAATCATCACACCGCTCTCCCCACCGCAGACACGTGGACCGAAATTCCACCGATCTCCGCCGCCGCCGCGCCGCCGCAGAACCACCACCAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

14.82

Weight (kDa)

9.59

Isoelectric Point (pI)

76.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DELLA PF12041 32 - 89 1.2e-26 Transcriptional regulator DELLA protein N terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 129, 340
AccI GTMKAC 1 cut(s) 261
AccII CGCG 1 cut(s) 394
AcoI YGGCCR 1 cut(s) 105
AcsI RAATTY 1 cut(s) 368
AcvI CACGTG 1 cut(s) 359
AcyI GRCGYC 3 cut(s) 27, 222, 314
AfaI GTAC 2 cut(s) 11, 119
AfeI AGCGCT 1 cut(s) 167
AfiI CCNNNNNNNGG 2 cut(s) 114, 414
AflIII ACRYGT 2 cut(s) 145, 356
AjiI CACGTC 1 cut(s) 148
AjnI CCWGG 3 cut(s) 254, 309, 413
AluBI AGCT 1 cut(s) 45
AluI AGCT 1 cut(s) 45
Ama87I CYCGRG 1 cut(s) 161
Aor51HI AGCGCT 1 cut(s) 167
AoxI GGCC 2 cut(s) 105, 111
ApeKI GCWGC 2 cut(s) 33, 36
ApoI RAATTY 1 cut(s) 368
AspLEI GCGC 4 cut(s) 41, 159, 168, 396
AspS9I GGNCC 2 cut(s) 124, 362
AsuC2I CCSGG 1 cut(s) 115
AvaI CYCGRG 1 cut(s) 161
AvaII GGWCC 2 cut(s) 124, 362
BbrPI CACGTG 1 cut(s) 359
BbvI GCAGC 2 cut(s) 45, 48
BccI CCATC 2 cut(s) 85, 298
BceAI ACGGC 2 cut(s) 28, 209
BciT130I CCWGG 3 cut(s) 256, 311, 415
BcnI CCSGG 1 cut(s) 115
BfoI RGCGCY 3 cut(s) 42, 160, 169
BlpI GCTNAGC 1 cut(s) 153
Bme1390I CCNGG 4 cut(s) 115, 256, 311, 415
Bme18I GGWCC 2 cut(s) 124, 362
BmeT110I CYCGRG 1 cut(s) 161
BmgBI CACGTC 1 cut(s) 148
BmgT120I GGNCC 2 cut(s) 124, 362
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 4 cut(s) 115, 256, 311, 415
Bpu1102I GCTNAGC 1 cut(s) 153
BpuMI CCSGG 1 cut(s) 115
BsaAI YACGTR 1 cut(s) 359
BsaHI GRCGYC 3 cut(s) 27, 222, 314
BsaJI CCNNGG 3 cut(s) 108, 255, 309
BsaXI ACNNNNNCTCC 6 cut(s) 200, 224, 230, 236, 254, 266
Bsc4I CCNNNNNNNGG 2 cut(s) 114, 414
BseBI CCWGG 3 cut(s) 256, 311, 415
BseDI CCNNGG 3 cut(s) 108, 255, 309
BseLI CCNNNNNNNGG 2 cut(s) 114, 414
BseMII CTCAG 1 cut(s) 167
BseRI GAGGAG 6 cut(s) 37, 46, 49, 121, 256, 259
BseXI GCAGC 2 cut(s) 45, 48
Bsh1236I CGCG 1 cut(s) 394
BshFI GGCC 2 cut(s) 107, 113
BsiHKCI CYCGRG 1 cut(s) 161
BsiSI CCGG 2 cut(s) 21, 114
BsiWI CGTACG 1 cut(s) 9
BslI CCNNNNNNNGG 2 cut(s) 114, 414
BsnI GGCC 2 cut(s) 107, 113
BsoBI CYCGRG 1 cut(s) 161
Bsp143I GATC 2 cut(s) 297, 377
Bsp1720I GCTNAGC 1 cut(s) 153
BspANI GGCC 2 cut(s) 107, 113
BspCNI CTCAG 1 cut(s) 166
BspFNI CGCG 1 cut(s) 394
BspLI GGNNCC 1 cut(s) 6
BsrBI CCGCTC 2 cut(s) 129, 340
BssECI CCNNGG 3 cut(s) 108, 255, 309
BssMI GATC 2 cut(s) 297, 377
BssNI GRCGYC 3 cut(s) 27, 222, 314
Bst2UI CCWGG 3 cut(s) 256, 311, 415
Bst6I CTCTTC 1 cut(s) 55
BstACI GRCGYC 3 cut(s) 27, 222, 314
BstBAI YACGTR 1 cut(s) 359
BstC8I GCNNGC 1 cut(s) 43
BstDEI CTNAG 1 cut(s) 153
BstFNI CGCG 1 cut(s) 394
BstH2I RGCGCY 3 cut(s) 42, 160, 169
BstHHI GCGC 4 cut(s) 41, 159, 168, 396
BstKTI GATC 2 cut(s) 300, 380
BstMBI GATC 2 cut(s) 297, 377
BstMWI GCNNNNNNNGC 9 cut(s) 21, 30, 33, 42, 163, 165, 212, 221, 391
BstNI CCWGG 3 cut(s) 256, 311, 415
BstSCI CCNGG 4 cut(s) 113, 254, 309, 413
BstUI CGCG 1 cut(s) 394
BstV1I GCAGC 2 cut(s) 45, 48
BsuRI GGCC 2 cut(s) 107, 113
BtrI CACGTC 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 43
CfoI GCGC 4 cut(s) 41, 159, 168, 396
Cfr13I GGNCC 2 cut(s) 124, 362
CseI GACGC 3 cut(s) 16, 230, 303
CsiI ACCWGGT 1 cut(s) 413
Csp6I GTAC 2 cut(s) 10, 118
CviAII CATG 2 cut(s) 86, 181
CviJI RGCY 5 cut(s) 7, 45, 82, 107, 113
CviKI_1 RGCY 5 cut(s) 7, 45, 82, 107, 113
CviQI GTAC 2 cut(s) 10, 118
DdeI CTNAG 1 cut(s) 153
DpnI GATC 2 cut(s) 299, 379
DpnII GATC 2 cut(s) 297, 377
EaeI YGGCCR 1 cut(s) 105
Eam1104I CTCTTC 1 cut(s) 55
EarI CTCTTC 1 cut(s) 55
EciI GGCGGA 2 cut(s) 264, 372
Eco47I GGWCC 2 cut(s) 124, 362
Eco47III AGCGCT 1 cut(s) 167
Eco72I CACGTG 1 cut(s) 359
Eco88I CYCGRG 1 cut(s) 161
EcoRII CCWGG 3 cut(s) 254, 309, 413
FaeI CATG 2 cut(s) 89, 184
FaiI YATR 3 cut(s) 74, 87, 182
FatI CATG 2 cut(s) 85, 180
FblI GTMKAC 1 cut(s) 261
GlaI GCGC 4 cut(s) 40, 158, 167, 395
HaeII RGCGCY 3 cut(s) 42, 160, 169
HaeIII GGCC 2 cut(s) 107, 113
HapII CCGG 2 cut(s) 21, 114
HgaI GACGC 3 cut(s) 16, 230, 303
HhaI GCGC 4 cut(s) 41, 159, 168, 396
Hin1I GRCGYC 3 cut(s) 27, 222, 314
Hin1II CATG 2 cut(s) 89, 184
Hin6I GCGC 4 cut(s) 39, 157, 166, 394
HinP1I GCGC 4 cut(s) 39, 157, 166, 394
HincII GTYRAC 2 cut(s) 187, 262
HindII GTYRAC 2 cut(s) 187, 262
HinfI GANTC 1 cut(s) 263
HpaII CCGG 2 cut(s) 21, 114
Hpy166II GTNNAC 3 cut(s) 187, 262, 362
Hpy188I TCNGA 5 cut(s) 136, 220, 244, 282, 297
Hpy188III TCNNGA 1 cut(s) 301
Hpy8I GTNNAC 3 cut(s) 187, 262, 362
Hpy99I CGWCG 2 cut(s) 152, 224
HpyCH4IV ACGT 3 cut(s) 147, 177, 358
HpyF10VI GCNNNNNNNGC 9 cut(s) 21, 30, 33, 42, 163, 165, 212, 221, 391
HpyF3I CTNAG 1 cut(s) 153
HpySE526I ACGT 3 cut(s) 147, 177, 358
Hsp92I GRCGYC 3 cut(s) 27, 222, 314
Hsp92II CATG 2 cut(s) 89, 184
HspAI GCGC 4 cut(s) 39, 157, 166, 394
Kzo9I GATC 2 cut(s) 297, 377
LmnI GCTCC 3 cut(s) 4, 50, 134
LpnPI CCDG 8 cut(s) 34, 55, 127, 241, 268, 296, 323, 400
Lsp1109I GCAGC 2 cut(s) 45, 48
MabI ACCWGGT 1 cut(s) 413
MaeII ACGT 3 cut(s) 147, 177, 358
MalI GATC 2 cut(s) 299, 379
MbiI CCGCTC 2 cut(s) 129, 340
MboI GATC 2 cut(s) 297, 377
MboII GAAGA 1 cut(s) 42
MluCI AATT 2 cut(s) 16, 368
MlyI GAGTC 1 cut(s) 257
MmeI TCCRAC 4 cut(s) 159, 243, 267, 305
MspI CCGG 2 cut(s) 21, 114
MspR9I CCNGG 4 cut(s) 115, 256, 311, 415
MvaI CCWGG 3 cut(s) 256, 311, 415
MvnI CGCG 1 cut(s) 394
MwoI GCNNNNNNNGC 9 cut(s) 21, 30, 33, 42, 163, 165, 212, 221, 391
NciI CCSGG 1 cut(s) 115
NdeII GATC 2 cut(s) 297, 377
NlaIII CATG 2 cut(s) 89, 184
NlaIV GGNNCC 1 cut(s) 6
NmeAIII GCCGAG 1 cut(s) 133
PaeR7I CTCGAG 1 cut(s) 161
Pfl23II CGTACG 1 cut(s) 9
PflFI GACNNNGTC 1 cut(s) 224
PleI GAGTC 1 cut(s) 257
PmaCI CACGTG 1 cut(s) 359
PmlI CACGTG 1 cut(s) 359
PpsI GAGTC 1 cut(s) 257
Ppu21I YACGTR 1 cut(s) 359
Psp6I CCWGG 3 cut(s) 254, 309, 413
PspCI CACGTG 1 cut(s) 359
PspGI CCWGG 3 cut(s) 254, 309, 413
PspLI CGTACG 1 cut(s) 9
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 2 cut(s) 124, 362
PspXI VCTCGAGB 1 cut(s) 161
PsyI GACNNNGTC 1 cut(s) 224
RsaI GTAC 2 cut(s) 11, 119
RsaNI GTAC 2 cut(s) 10, 118
SalI GTCGAC 1 cut(s) 260
Sau3AI GATC 2 cut(s) 297, 377
Sau96I GGNCC 2 cut(s) 124, 362
SchI GAGTC 1 cut(s) 257
ScrFI CCNGG 4 cut(s) 115, 256, 311, 415
SexAI ACCWGGT 1 cut(s) 413
Sfr274I CTCGAG 1 cut(s) 161
SinI GGWCC 2 cut(s) 124, 362
SlaI CTCGAG 1 cut(s) 161
SmlI CTYRAG 1 cut(s) 161
SmoI CTYRAG 1 cut(s) 161
Sse9I AATT 2 cut(s) 16, 368
StyD4I CCNGG 4 cut(s) 113, 254, 309, 413
TaiI ACGT 3 cut(s) 150, 180, 361
TaqI TCGA 3 cut(s) 162, 261, 302
TaqII GACCGA 1 cut(s) 379
TasI AATT 2 cut(s) 16, 368
TauI GCSGC 8 cut(s) 27, 68, 85, 388, 391, 394, 399, 402
TseI GCWGC 2 cut(s) 33, 36
Tth111I GACNNNGTC 1 cut(s) 224
VpaK11BI GGWCC 2 cut(s) 124, 362
XapI RAATTY 1 cut(s) 368
XhoI CTCGAG 1 cut(s) 161
XmiI GTMKAC 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.