Rroxscaffold_3G00225920

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
9319529 .. 9322121
2593 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00225920.1

Sequence Viewer

Length: 177 bp
ATGAGAATTGGAGAGCGGATTGGGCAAGGTAATGATCTTTCAACTGCCCACTACCTACAAAACAAAGTCGAACTATATACCATGAAAGCACTTCTTGGGCTGACAGGTGCCTCTCATCTCAATTTTTCTTATTGCAGTGGAAGTTTGTTTCATTTACTACAGAACAACAAGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.44

Weight (kDa)

8.98

Isoelectric Point (pI)

22.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 107
AccBSI CCGCTC 1 cut(s) 16
AciI CCGC 1 cut(s) 16
AgsI TTSAA 1 cut(s) 42
BanI GGYRCC 1 cut(s) 107
BfmI CTRYAG 1 cut(s) 158
BmiI GGNNCC 1 cut(s) 109
BshNI GGYRCC 1 cut(s) 107
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 1 cut(s) 16
BspLI GGNNCC 1 cut(s) 109
BspT107I GGYRCC 1 cut(s) 107
BsrBI CCGCTC 1 cut(s) 16
BssMI GATC 1 cut(s) 34
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 22
BstSFI CTRYAG 1 cut(s) 158
BtsI GCAGTG 1 cut(s) 142
BtsIMutI CAGTG 1 cut(s) 142
CviAII CATG 1 cut(s) 82
CviJI RGCY 1 cut(s) 100
CviKI_1 RGCY 1 cut(s) 100
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
FaeI CATG 1 cut(s) 85
FaiI YATR 4 cut(s) 76, 78, 83, 175
FalI AAGNNNNNCTT 2 cut(s) 78, 110
FatI CATG 1 cut(s) 81
Hin1II CATG 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 135
HpyF10VI GCNNNNNNNGC 1 cut(s) 22
Hsp92II CATG 1 cut(s) 85
Kzo9I GATC 1 cut(s) 34
LpnPI CCDG 1 cut(s) 90
MalI GATC 1 cut(s) 36
MbiI CCGCTC 1 cut(s) 16
MboI GATC 1 cut(s) 34
MluCI AATT 2 cut(s) 6, 121
MnlI CCTC 1 cut(s) 121
MwoI GCNNNNNNNGC 1 cut(s) 22
NdeII GATC 1 cut(s) 34
NlaIII CATG 1 cut(s) 85
NlaIV GGNNCC 1 cut(s) 109
PspN4I GGNNCC 1 cut(s) 109
Sau3AI GATC 1 cut(s) 34
SetI ASST 3 cut(s) 31, 57, 109
SfcI CTRYAG 1 cut(s) 158
SgeI CNNG 4 cut(s) 38, 94, 107, 117
Sse9I AATT 2 cut(s) 6, 121
SsiI CCGC 1 cut(s) 16
TaqI TCGA 1 cut(s) 69
TasI AATT 2 cut(s) 6, 121
TscAI CASTG 1 cut(s) 142
TspDTI ATGAA 2 cut(s) 98, 140
TspRI CASTG 1 cut(s) 142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.