Rh4AG259300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
57516152 .. 57516867
716 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG259300.1

Sequence Viewer

Length: 216 bp
ATGAAGCAGCCACTCTCAGATACTTCCACAGTTCCACCTGGTATTGAAAAGTGTTCTATAGCAGTCGATAGAGGACTCAGCTCAGGAGGGCCAAGCCTGGAGCATGTGAAGGAAGATTCTAAAAAAGCTCATGAATGGCGAAGTCCAATATATCAGAGAAGAAGGATGTTATTGGAGCTTCCTGTCGCTCCAAGAGGCACAAGGAGTGATGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.9

Weight (kDa)

8.98

Isoelectric Point (pI)

67.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 47
AjnI CCWGG 2 cut(s) 37, 96
AluBI AGCT 3 cut(s) 81, 128, 178
AluI AGCT 3 cut(s) 81, 128, 178
AoxI GGCC 1 cut(s) 89
ApeKI GCWGC 1 cut(s) 7
AspS9I GGNCC 1 cut(s) 89
BbvI GCAGC 1 cut(s) 19
BciT130I CCWGG 2 cut(s) 39, 98
BfmI CTRYAG 1 cut(s) 57
BisI GCNGC 1 cut(s) 8
BlsI GCNGC 1 cut(s) 9
Bme1390I CCNGG 2 cut(s) 39, 98
BmgT120I GGNCC 1 cut(s) 89
BmrFI CCNGG 2 cut(s) 39, 98
BpmI CTGGAG 1 cut(s) 119
Bpu10I CCTNAGC 1 cut(s) 82
BseBI CCWGG 2 cut(s) 39, 98
BseGI GGATG 1 cut(s) 171
BseMII CTCAG 3 cut(s) 30, 91, 96
BseXI GCAGC 1 cut(s) 19
BshFI GGCC 1 cut(s) 91
BsnI GGCC 1 cut(s) 91
BspANI GGCC 1 cut(s) 91
BspCNI CTCAG 3 cut(s) 29, 90, 95
BspHI TCATGA 1 cut(s) 130
Bst2UI CCWGG 2 cut(s) 39, 98
Bst4CI ACNGT 1 cut(s) 31
BstDEI CTNAG 3 cut(s) 16, 77, 82
BstF5I GGATG 1 cut(s) 171
BstNI CCWGG 2 cut(s) 39, 98
BstNSI RCATGY 1 cut(s) 107
BstSCI CCNGG 2 cut(s) 37, 96
BstSFI CTRYAG 1 cut(s) 57
BstV1I GCAGC 1 cut(s) 19
BsuRI GGCC 1 cut(s) 91
BtsCI GGATG 1 cut(s) 171
CciI TCATGA 1 cut(s) 130
Cfr13I GGNCC 1 cut(s) 89
CsiI ACCWGGT 1 cut(s) 37
CviAII CATG 2 cut(s) 104, 131
CviJI RGCY 6 cut(s) 10, 81, 91, 96, 128, 178
CviKI_1 RGCY 6 cut(s) 10, 81, 91, 96, 128, 178
DdeI CTNAG 3 cut(s) 16, 77, 82
EcoRII CCWGG 2 cut(s) 37, 96
FaeI CATG 2 cut(s) 107, 134
FaiI YATR 4 cut(s) 59, 105, 132, 151
FatI CATG 2 cut(s) 103, 130
Fnu4HI GCNGC 1 cut(s) 8
FokI GGATG 1 cut(s) 178
Fsp4HI GCNGC 1 cut(s) 8
GluI GCNGC 1 cut(s) 8
GsuI CTGGAG 1 cut(s) 119
HaeIII GGCC 1 cut(s) 91
Hin1II CATG 2 cut(s) 107, 134
HinfI GANTC 2 cut(s) 75, 116
Hpy188I TCNGA 2 cut(s) 19, 156
Hpy188III TCNNGA 2 cut(s) 84, 131
HpyAV CCTTC 2 cut(s) 103, 156
HpyCH4III ACNGT 1 cut(s) 31
HpyF3I CTNAG 3 cut(s) 16, 77, 82
Hsp92II CATG 2 cut(s) 107, 134
LmnI GCTCC 3 cut(s) 100, 175, 193
LpnPI CCDG 6 cut(s) 24, 51, 69, 83, 110, 195
Lsp1109I GCAGC 1 cut(s) 19
MabI ACCWGGT 1 cut(s) 37
MboII GAAGA 2 cut(s) 125, 171
MlyI GAGTC 1 cut(s) 69
MnlI CCTC 3 cut(s) 65, 80, 188
MspR9I CCNGG 2 cut(s) 39, 98
MvaI CCWGG 2 cut(s) 39, 98
NlaIII CATG 2 cut(s) 107, 134
NspI RCATGY 1 cut(s) 107
PagI TCATGA 1 cut(s) 130
PfeI GAWTC 1 cut(s) 116
PkrI GCNGC 1 cut(s) 9
PleI GAGTC 1 cut(s) 69
PpsI GAGTC 1 cut(s) 69
Psp6I CCWGG 2 cut(s) 37, 96
PspGI CCWGG 2 cut(s) 37, 96
PspPI GGNCC 1 cut(s) 89
SatI GCNGC 1 cut(s) 8
Sau96I GGNCC 1 cut(s) 89
SchI GAGTC 1 cut(s) 69
ScrFI CCNGG 2 cut(s) 39, 98
SetI ASST 4 cut(s) 40, 83, 130, 180
SexAI ACCWGGT 1 cut(s) 37
SfcI CTRYAG 1 cut(s) 57
StyD4I CCNGG 2 cut(s) 37, 96
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 66
TfiI GAWTC 1 cut(s) 116
TseI GCWGC 1 cut(s) 7
TspDTI ATGAA 2 cut(s) 17, 147
XceI RCATGY 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.