Rroxscaffold_4G00307300

Plastocyanin-like domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
28479217 .. 28480213
997 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00307300.1

Sequence Viewer

Length: 552 bp
ATGGCCCTGGCAATAGCTTTCCTTATACTCATGGTGGCAGCTCCAGCTGCAGTTTATGGAGCTGAGCACACTGTTGGTGATACCCAGGGATGGAACCAAGGTGTAAATTATGACACTTGGGCTTCCGGCAAAACCTTCACCGTCGGTGACACTCTTGTGTTCAACTATGACAGTAGCCACAAAGTTGATGAGGTAAACCTAGCAGACTACAACGGTTGCAGTTCAAGTAATTCCATCAAAACCTATGAAGATAGTCCCACAAATATCACCCTCTCCAAAGCTGGTCCAAGCTACTACATTTGCCCTATCCCAGGTCACTGTGCTAGTGGCATGAAGCTTTTGGTCAATGTTGTGGCGGCTGGCACCCCTAGTAGCACCCCGCCTACTACTAGCCCCGCCACGCCAGCTCCACCCACCAACACAACTCCTGCCAATAATGACTCGCCACCTCCGCCACCGCCACCGCCTAAGATATCACCAGCGAGTAGTCTTCACATGAATTTGGTTGGGGTTCCACTTGTGTTGGCAACCTTGGTGGCAGTTATAGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

18.81

Weight (kDa)

5.03

Isoelectric Point (pI)

44.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu_bind_like PF02298 31 - 111 2.4e-27 Plastocyanin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 362
AciI CCGC 6 cut(s) 356, 380, 396, 452, 458, 464
AcsI RAATTY 1 cut(s) 499
AfiI CCNNNNNNNGG 2 cut(s) 90, 311
AgsI TTSAA 2 cut(s) 163, 225
AjnI CCWGG 3 cut(s) 6, 84, 310
AleI CACNNNNGTG 1 cut(s) 155
AluBI AGCT 8 cut(s) 17, 41, 47, 62, 281, 291, 337, 407
AluI AGCT 8 cut(s) 17, 41, 47, 62, 281, 291, 337, 407
Alw21I GWGCWC 1 cut(s) 69
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 38, 47
ApoI RAATTY 1 cut(s) 499
AspS9I GGNCC 2 cut(s) 4, 284
AsuHPI GGTGA 5 cut(s) 89, 130, 158, 259, 468
AvaII GGWCC 1 cut(s) 284
BanI GGYRCC 1 cut(s) 362
BbsI GAAGAC 1 cut(s) 482
Bbv12I GWGCWC 1 cut(s) 69
BbvI GCAGC 2 cut(s) 34, 50
BccI CCATC 2 cut(s) 84, 242
BciT130I CCWGG 3 cut(s) 8, 86, 312
BfaI CTAG 5 cut(s) 200, 324, 369, 390, 550
BfmI CTRYAG 1 cut(s) 48
BisI GCNGC 3 cut(s) 39, 48, 357
BlpI GCTNAGC 1 cut(s) 63
BlsI GCNGC 3 cut(s) 40, 49, 358
Bme1390I CCNGG 3 cut(s) 8, 86, 312
Bme18I GGWCC 1 cut(s) 284
BmgT120I GGNCC 2 cut(s) 4, 284
BmiI GGNNCC 3 cut(s) 95, 364, 513
BmrFI CCNGG 3 cut(s) 8, 86, 312
BpiI GAAGAC 1 cut(s) 482
BpmI CTGGAG 1 cut(s) 27
Bpu1102I GCTNAGC 1 cut(s) 63
BsaJI CCNNGG 6 cut(s) 6, 84, 85, 97, 310, 531
BsaXI ACNNNNNCTCC 2 cut(s) 391, 421
Bsc4I CCNNNNNNNGG 2 cut(s) 90, 311
BseBI CCWGG 3 cut(s) 8, 86, 312
BseDI CCNNGG 6 cut(s) 6, 84, 85, 97, 310, 531
BseGI GGATG 1 cut(s) 95
BseLI CCNNNNNNNGG 2 cut(s) 90, 311
BseMII CTCAG 1 cut(s) 54
BseXI GCAGC 2 cut(s) 34, 50
BshFI GGCC 1 cut(s) 5
BshNI GGYRCC 1 cut(s) 362
BsiHKAI GWGCWC 1 cut(s) 69
BsiSI CCGG 1 cut(s) 126
BslFI GGGAC 1 cut(s) 240
BslI CCNNNNNNNGG 2 cut(s) 90, 311
BsmFI GGGAC 1 cut(s) 240
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 69
Bsp1720I GCTNAGC 1 cut(s) 63
BspACI CCGC 6 cut(s) 356, 380, 396, 452, 458, 464
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 55
BspLI GGNNCC 3 cut(s) 95, 364, 513
BspMAI CTGCAG 1 cut(s) 52
BspT107I GGYRCC 1 cut(s) 362
BssECI CCNNGG 6 cut(s) 6, 84, 85, 97, 310, 531
BssT1I CCWWGG 2 cut(s) 97, 531
Bst2UI CCWGG 3 cut(s) 8, 86, 312
Bst4CI ACNGT 5 cut(s) 73, 142, 173, 215, 320
BstC8I GCNNGC 2 cut(s) 361, 405
BstDEI CTNAG 2 cut(s) 63, 468
BstENI CCTNNNNNAGG 1 cut(s) 309
BstF5I GGATG 1 cut(s) 95
BstMWI GCNNNNNNNGC 4 cut(s) 44, 47, 404, 451
BstNI CCWGG 3 cut(s) 8, 86, 312
BstSCI CCNGG 3 cut(s) 6, 84, 310
BstSFI CTRYAG 1 cut(s) 48
BstV1I GCAGC 2 cut(s) 34, 50
BstV2I GAAGAC 1 cut(s) 482
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 95
BtsIMutI CAGTG 2 cut(s) 69, 316
Cac8I GCNNGC 2 cut(s) 361, 405
Cfr13I GGNCC 2 cut(s) 4, 284
CspCI CAANNNNNGTGG 4 cut(s) 504, 516, 539, 551
CviAII CATG 3 cut(s) 31, 331, 496
DdeI CTNAG 2 cut(s) 63, 468
EciI GGCGGA 1 cut(s) 441
Eco130I CCWWGG 2 cut(s) 97, 531
Eco32I GATATC 1 cut(s) 474
Eco47I GGWCC 1 cut(s) 284
EcoNI CCTNNNNNAGG 1 cut(s) 309
EcoRII CCWGG 3 cut(s) 6, 84, 310
EcoRV GATATC 1 cut(s) 474
EcoT14I CCWWGG 2 cut(s) 97, 531
ErhI CCWWGG 2 cut(s) 97, 531
FaeI CATG 3 cut(s) 34, 334, 499
FaiI YATR 9 cut(s) 26, 32, 57, 111, 168, 246, 332, 497, 545
FaqI GGGAC 1 cut(s) 240
FatI CATG 3 cut(s) 30, 330, 495
FauI CCCGC 2 cut(s) 387, 403
Fnu4HI GCNGC 3 cut(s) 39, 48, 357
FokI GGATG 1 cut(s) 102
Fsp4HI GCNGC 3 cut(s) 39, 48, 357
FspBI CTAG 5 cut(s) 200, 324, 369, 390, 550
GluI GCNGC 3 cut(s) 39, 48, 357
GsuI CTGGAG 1 cut(s) 27
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 126
Hin1II CATG 3 cut(s) 34, 334, 499
HindIII AAGCTT 1 cut(s) 335
HinfI GANTC 1 cut(s) 440
HpaII CCGG 1 cut(s) 126
HphI GGTGA 5 cut(s) 89, 130, 158, 259, 468
Hpy166II GTNNAC 1 cut(s) 196
Hpy8I GTNNAC 1 cut(s) 196
Hpy99I CGWCG 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 145
HpyCH4III ACNGT 5 cut(s) 73, 142, 173, 215, 320
HpyCH4V TGCA 2 cut(s) 50, 219
HpyF10VI GCNNNNNNNGC 4 cut(s) 44, 47, 404, 451
HpyF3I CTNAG 2 cut(s) 63, 468
Hsp92II CATG 3 cut(s) 34, 334, 499
LmnI GCTCC 3 cut(s) 46, 59, 412
Lsp1109I GCAGC 2 cut(s) 34, 50
MaeI CTAG 5 cut(s) 200, 324, 369, 390, 550
MaeIII GTNAC 2 cut(s) 146, 314
MboII GAAGA 2 cut(s) 260, 482
MhlI GDGCHC 1 cut(s) 69
MluCI AATT 3 cut(s) 106, 229, 499
MlyI GAGTC 1 cut(s) 434
MnlI CCTC 3 cut(s) 184, 281, 459
MslI CAYNNNNRTG 1 cut(s) 155
MspA1I CMGCKG 1 cut(s) 47
MspI CCGG 1 cut(s) 126
MspR9I CCNGG 3 cut(s) 8, 86, 312
MvaI CCWGG 3 cut(s) 8, 86, 312
MwoI GCNNNNNNNGC 4 cut(s) 44, 47, 404, 451
NlaIII CATG 3 cut(s) 34, 334, 499
NlaIV GGNNCC 3 cut(s) 95, 364, 513
NmuCI GTSAC 2 cut(s) 146, 314
OliI CACNNNNGTG 1 cut(s) 155
PasI CCCWGGG 1 cut(s) 85
PkrI GCNGC 3 cut(s) 40, 49, 358
PleI GAGTC 1 cut(s) 434
PpsI GAGTC 1 cut(s) 434
Psp6I CCWGG 3 cut(s) 6, 84, 310
PspGI CCWGG 3 cut(s) 6, 84, 310
PspN4I GGNNCC 3 cut(s) 95, 364, 513
PspPI GGNCC 2 cut(s) 4, 284
PstI CTGCAG 1 cut(s) 52
PvuII CAGCTG 1 cut(s) 47
RseI CAYNNNNRTG 1 cut(s) 155
SatI GCNGC 3 cut(s) 39, 48, 357
Sau96I GGNCC 2 cut(s) 4, 284
SchI GAGTC 1 cut(s) 434
ScrFI CCNGG 3 cut(s) 8, 86, 312
SduI GDGCHC 1 cut(s) 69
SfcI CTRYAG 1 cut(s) 48
SinI GGWCC 1 cut(s) 284
SmiMI CAYNNNNRTG 1 cut(s) 155
Sse9I AATT 3 cut(s) 106, 229, 499
SsiI CCGC 6 cut(s) 356, 380, 396, 452, 458, 464
SspMI CTAG 5 cut(s) 200, 324, 369, 390, 550
StyD4I CCNGG 3 cut(s) 6, 84, 310
StyI CCWWGG 2 cut(s) 97, 531
TaaI ACNGT 5 cut(s) 73, 142, 173, 215, 320
TasI AATT 3 cut(s) 106, 229, 499
TauI GCSGC 1 cut(s) 359
TscAI CASTG 2 cut(s) 76, 323
TseFI GTSAC 2 cut(s) 146, 314
TseI GCWGC 2 cut(s) 38, 47
Tsp45I GTSAC 2 cut(s) 146, 314
TspDTI ATGAA 3 cut(s) 261, 347, 512
TspRI CASTG 2 cut(s) 76, 323
VpaK11BI GGWCC 1 cut(s) 284
XagI CCTNNNNNAGG 1 cut(s) 309
XapI RAATTY 1 cut(s) 499
XspI CTAG 5 cut(s) 200, 324, 369, 390, 550
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.