Rroxscaffold_4G00308580

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
30113428 .. 30135264
21837 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00308580.1

Sequence Viewer

Length: 294 bp
ATGGAAATCTGGAAGGGTAGGTTCACTGTGAGACAAAAACTGCGGTCCAGATACTACAAGTACGGTCATGCCATTTGGACATCAACATTCATCAATTATTGTGACAACCTGGGACAACAATTATTTTTGCCGTCGCATTGTGAAAGATTCGATCATAGTCCTGCATCTTGCGCTATTGTTGTTATTGCTATTGTCGTCCTAACTCTATCACTCAAGCTTCATGGTGATGGAAAGTTGGGCAATTTTGAAGGTGCATCGTGGAAAGAATATGATCTGGAAGAAAGAGATGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.28

Weight (kDa)

6.89

Isoelectric Point (pI)

35.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 43
AfaI GTAC 1 cut(s) 62
AgsI TTSAA 1 cut(s) 248
AjnI CCWGG 1 cut(s) 108
AluBI AGCT 1 cut(s) 217
AluI AGCT 1 cut(s) 217
Alw26I GTCTC 1 cut(s) 25
AspLEI GCGC 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 45
AsuHPI GGTGA 1 cut(s) 236
AvaII GGWCC 1 cut(s) 45
BccI CCATC 1 cut(s) 221
BceAI ACGGC 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 25
Bme1390I CCNGG 1 cut(s) 110
Bme18I GGWCC 1 cut(s) 45
BmgT120I GGNCC 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 110
BmsI GCATC 2 cut(s) 173, 263
BpuEI CTTGAG 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 109
BseBI CCWGG 1 cut(s) 110
BseDI CCNNGG 1 cut(s) 109
BslFI GGGAC 1 cut(s) 126
BsmAI GTCTC 1 cut(s) 25
BsmFI GGGAC 1 cut(s) 126
Bsp143I GATC 2 cut(s) 151, 271
BspACI CCGC 1 cut(s) 43
BssECI CCNNGG 1 cut(s) 109
BssMI GATC 2 cut(s) 151, 271
Bst2UI CCWGG 1 cut(s) 110
Bst4CI ACNGT 2 cut(s) 28, 65
BstHHI GCGC 1 cut(s) 173
BstKTI GATC 2 cut(s) 154, 274
BstMAI GTCTC 1 cut(s) 25
BstMBI GATC 2 cut(s) 151, 271
BstMWI GCNNNNNNNGC 1 cut(s) 170
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 24
CfoI GCGC 1 cut(s) 173
Cfr13I GGNCC 1 cut(s) 45
Csp6I GTAC 1 cut(s) 61
CviAII CATG 2 cut(s) 68, 221
CviJI RGCY 1 cut(s) 217
CviKI_1 RGCY 1 cut(s) 217
CviQI GTAC 1 cut(s) 61
DpnI GATC 2 cut(s) 153, 273
DpnII GATC 2 cut(s) 151, 271
Eco47I GGWCC 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 108
FaeI CATG 2 cut(s) 71, 224
FaiI YATR 4 cut(s) 69, 156, 222, 270
FaqI GGGAC 1 cut(s) 126
FatI CATG 2 cut(s) 67, 220
GlaI GCGC 1 cut(s) 172
HhaI GCGC 1 cut(s) 173
Hin1II CATG 2 cut(s) 71, 224
Hin6I GCGC 1 cut(s) 171
HinP1I GCGC 1 cut(s) 171
HindIII AAGCTT 1 cut(s) 215
HinfI GANTC 1 cut(s) 147
HphI GGTGA 1 cut(s) 236
Hpy166II GTNNAC 1 cut(s) 24
Hpy188III TCNNGA 3 cut(s) 10, 48, 275
Hpy8I GTNNAC 1 cut(s) 24
Hpy99I CGWCG 1 cut(s) 136
HpyAV CCTTC 2 cut(s) 7, 242
HpyCH4III ACNGT 2 cut(s) 28, 65
HpyCH4V TGCA 2 cut(s) 164, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 170
Hsp92II CATG 2 cut(s) 71, 224
HspAI GCGC 1 cut(s) 171
Kzo9I GATC 2 cut(s) 151, 271
LpnPI CCDG 5 cut(s) 61, 95, 122, 174, 260
LweI GCATC 2 cut(s) 173, 263
MaeIII GTNAC 1 cut(s) 101
MalI GATC 2 cut(s) 153, 273
MboI GATC 2 cut(s) 151, 271
MboII GAAGA 1 cut(s) 290
MluCI AATT 3 cut(s) 94, 119, 241
MslI CAYNNNNRTG 1 cut(s) 225
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
MwoI GCNNNNNNNGC 1 cut(s) 170
NdeII GATC 2 cut(s) 151, 271
NlaIII CATG 2 cut(s) 71, 224
NmuCI GTSAC 1 cut(s) 101
PfeI GAWTC 1 cut(s) 147
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
PspPI GGNCC 1 cut(s) 45
RsaI GTAC 1 cut(s) 62
RsaNI GTAC 1 cut(s) 61
RseI CAYNNNNRTG 1 cut(s) 225
Sau3AI GATC 2 cut(s) 151, 271
Sau96I GGNCC 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 110
SetI ASST 4 cut(s) 23, 111, 219, 253
SfaNI GCATC 2 cut(s) 173, 263
SinI GGWCC 1 cut(s) 45
SmiMI CAYNNNNRTG 1 cut(s) 225
SmlI CTYRAG 1 cut(s) 212
SmoI CTYRAG 1 cut(s) 212
Sse9I AATT 3 cut(s) 94, 119, 241
SsiI CCGC 1 cut(s) 43
StyD4I CCNGG 1 cut(s) 108
TaaI ACNGT 2 cut(s) 28, 65
TaqI TCGA 1 cut(s) 150
TasI AATT 3 cut(s) 94, 119, 241
TfiI GAWTC 1 cut(s) 147
TscAI CASTG 1 cut(s) 31
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspDTI ATGAA 2 cut(s) 79, 209
TspRI CASTG 1 cut(s) 31
VpaK11BI GGWCC 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.