Rroxscaffold_5G00344270

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
14259138 .. 14293759
34622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00344270.1

Sequence Viewer

Length: 330 bp
ATGGGTTTTGTCCTTTTCATTTCTCGAATTAATTTGTCCATCTCGGATACAAGTCCGTTCAATCTCATATTTGGGAGGCCGGAGAATGGAAGAAGGGTTACTAATGGTGTTAATGGCTTCAGCCAAAGATACTATGGTAATAGAAGGGTTACTAATAGGATTAGTCAAGAGAATCGAAAAAAGAAGCAAAACCAAAGCTCGTTATTGATGCCAACGGGTGGCAAGAAGTTAATTGACATCAAACTTGAGCAACATATCCAAGAACTGAAAGAAGAAGTGAAAAGGATGCTAATGGCTCCAGTTAACAAGCTTCAGAAAGATTTGACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.61

Weight (kDa)

10.61

Isoelectric Point (pI)

55.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016832)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 218
AcuI CTGAAG 2 cut(s) 103, 296
AfiI CCNNNNNNNGG 2 cut(s) 86, 218
AgsI TTSAA 1 cut(s) 61
AluBI AGCT 2 cut(s) 198, 310
AluI AGCT 2 cut(s) 198, 310
AoxI GGCC 1 cut(s) 77
AseI ATTAAT 1 cut(s) 30
BaeI ACNNNNGTAYC 2 cut(s) 121, 154
BarI GAAGNNNNNNTAC 2 cut(s) 82, 114
BccI CCATC 1 cut(s) 47
BciVI GTATCC 1 cut(s) 40
BfuI GTATCC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 297
BmsI GCATC 2 cut(s) 198, 276
BpmI CTGGAG 1 cut(s) 282
BpuEI CTTGAG 1 cut(s) 266
Bsc4I CCNNNNNNNGG 2 cut(s) 86, 218
Bse1I ACTGG 1 cut(s) 299
BseGI GGATG 1 cut(s) 291
BseLI CCNNNNNNNGG 2 cut(s) 86, 218
BseNI ACTGG 1 cut(s) 299
BshFI GGCC 1 cut(s) 79
BsiSI CCGG 1 cut(s) 80
BslI CCNNNNNNNGG 2 cut(s) 86, 218
BsnI GGCC 1 cut(s) 79
BspANI GGCC 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 297
BsrI ACTGG 1 cut(s) 299
BstF5I GGATG 1 cut(s) 291
BsuI GTATCC 1 cut(s) 40
BsuRI GGCC 1 cut(s) 79
BtsCI GGATG 1 cut(s) 291
CviAII CATG 1 cut(s) 327
CviJI RGCY 6 cut(s) 79, 117, 123, 198, 296, 310
CviKI_1 RGCY 6 cut(s) 79, 117, 123, 198, 296, 310
Eco57I CTGAAG 2 cut(s) 103, 296
FaeI CATG 1 cut(s) 330
FaiI YATR 4 cut(s) 68, 135, 255, 328
FatI CATG 1 cut(s) 326
FokI GGATG 1 cut(s) 298
GsuI CTGGAG 1 cut(s) 282
HaeIII GGCC 1 cut(s) 79
HapII CCGG 1 cut(s) 80
Hin1II CATG 1 cut(s) 330
HincII GTYRAC 1 cut(s) 304
HindII GTYRAC 1 cut(s) 304
HindIII AAGCTT 1 cut(s) 308
HinfI GANTC 1 cut(s) 172
HpaI GTTAAC 1 cut(s) 304
HpaII CCGG 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 304
Hpy188I TCNGA 2 cut(s) 46, 315
Hpy188III TCNNGA 2 cut(s) 24, 167
Hpy8I GTNNAC 1 cut(s) 304
HpyAV CCTTC 2 cut(s) 87, 138
Hsp92II CATG 1 cut(s) 330
KspAI GTTAAC 1 cut(s) 304
LmnI GCTCC 1 cut(s) 301
LpnPI CCDG 2 cut(s) 93, 312
LweI GCATC 2 cut(s) 198, 276
MaeIII GTNAC 2 cut(s) 97, 148
MboII GAAGA 2 cut(s) 102, 284
MluCI AATT 3 cut(s) 27, 31, 231
MnlI CCTC 1 cut(s) 69
MseI TTAA 4 cut(s) 30, 111, 230, 303
MspI CCGG 1 cut(s) 80
NlaIII CATG 1 cut(s) 330
NlaIV GGNNCC 1 cut(s) 297
PfeI GAWTC 1 cut(s) 172
PflMI CCANNNNNTGG 1 cut(s) 218
PshBI ATTAAT 1 cut(s) 30
PspN4I GGNNCC 1 cut(s) 297
SaqAI TTAA 4 cut(s) 30, 111, 230, 303
SetI ASST 2 cut(s) 200, 312
SfaNI GCATC 2 cut(s) 198, 276
SmlI CTYRAG 1 cut(s) 245
SmoI CTYRAG 1 cut(s) 245
Sse9I AATT 3 cut(s) 27, 31, 231
TaqI TCGA 2 cut(s) 25, 175
TasI AATT 3 cut(s) 27, 31, 231
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 4 cut(s) 30, 111, 230, 303
Tru9I TTAA 4 cut(s) 30, 111, 230, 303
TspDTI ATGAA 1 cut(s) 7
TspGWI ACGGA 1 cut(s) 45
Van91I CCANNNNNTGG 1 cut(s) 218
VspI ATTAAT 1 cut(s) 30
XcmI CCANNNNNNNNNTGG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.