Rroxscaffold_5G00373120

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
54372324 .. 54378678
6355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00373120.1

Sequence Viewer

Length: 291 bp
ATGATTAATTTGATCAATGTGGACGTAGAAAGAATTGGAGACTTCGCTGGTATATTCATGGAATTTGGTTGCTTCCTCTTCAAGTCTTCTTTGCCTTGGTTATCCACTTTTCAAAAGGGATCGAAACCAAAAGGAGAAACTATCTCATATACTTCAAGAAGAGCCGAGAGTGCTTCTCCTTTGCTCCAAGAATCACTCGAACACCACTCTTCGTTATTAAAAGCCATACGAGGGCTGGATGGAAATCACTATCCAAAAATGCAGTTTTTGCAGGTAACACAACTCACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.84

Weight (kDa)

7.92

Isoelectric Point (pI)

36.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 262
AclWI GGATC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 62
AfiI CCNNNNNNNGG 1 cut(s) 231
AgsI TTSAA 3 cut(s) 82, 113, 156
Alw26I GTCTC 1 cut(s) 33
AlwI GGATC 1 cut(s) 127
ApoI RAATTY 1 cut(s) 62
AseI ATTAAT 1 cut(s) 6
BbsI GAAGAC 1 cut(s) 78
BccI CCATC 1 cut(s) 233
BclI TGATCA 1 cut(s) 12
BcoDI GTCTC 1 cut(s) 33
BfuAI ACCTGC 1 cut(s) 262
BpiI GAAGAC 1 cut(s) 78
BplI GAGNNNNNCTC 2 cut(s) 160, 192
BsaBI GATNNNNATC 1 cut(s) 243
BsaJI CCNNGG 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 231
Bse8I GATNNNNATC 1 cut(s) 243
BseDI CCNNGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 244
BseJI GATNNNNATC 1 cut(s) 243
BseLI CCNNNNNNNGG 1 cut(s) 231
BslI CCNNNNNNNGG 1 cut(s) 231
BsmAI GTCTC 1 cut(s) 33
Bsp143I GATC 2 cut(s) 12, 119
BspMI ACCTGC 1 cut(s) 262
BspPI GGATC 1 cut(s) 127
BspQI GCTCTTC 1 cut(s) 154
BssECI CCNNGG 1 cut(s) 95
BssMI GATC 2 cut(s) 12, 119
BssT1I CCWWGG 1 cut(s) 95
Bst6I CTCTTC 3 cut(s) 83, 154, 214
BstAPI GCANNNNNTGC 1 cut(s) 268
BstDEI CTNAG 1 cut(s) 288
BstF5I GGATG 1 cut(s) 244
BstKTI GATC 2 cut(s) 15, 122
BstMAI GTCTC 1 cut(s) 33
BstMBI GATC 2 cut(s) 12, 119
BstMWI GCNNNNNNNGC 2 cut(s) 170, 268
BstV2I GAAGAC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 244
BveI ACCTGC 1 cut(s) 262
CviAII CATG 1 cut(s) 58
CviJI RGCY 3 cut(s) 164, 224, 235
CviKI_1 RGCY 3 cut(s) 164, 224, 235
DdeI CTNAG 1 cut(s) 288
DpnI GATC 2 cut(s) 14, 121
DpnII GATC 2 cut(s) 12, 119
Eam1104I CTCTTC 3 cut(s) 83, 154, 214
EarI CTCTTC 3 cut(s) 83, 154, 214
Eco130I CCWWGG 1 cut(s) 95
EcoT14I CCWWGG 1 cut(s) 95
ErhI CCWWGG 1 cut(s) 95
FaeI CATG 1 cut(s) 61
FaiI YATR 5 cut(s) 53, 59, 148, 150, 227
FatI CATG 1 cut(s) 57
FbaI TGATCA 1 cut(s) 12
FokI GGATG 1 cut(s) 251
Hin1II CATG 1 cut(s) 61
HinfI GANTC 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 156
Hpy8I GTNNAC 1 cut(s) 22
HpyCH4IV ACGT 1 cut(s) 24
HpyCH4V TGCA 2 cut(s) 262, 271
HpyF10VI GCNNNNNNNGC 2 cut(s) 170, 268
HpyF3I CTNAG 1 cut(s) 288
HpySE526I ACGT 1 cut(s) 24
Hsp92II CATG 1 cut(s) 61
Ksp22I TGATCA 1 cut(s) 12
Kzo9I GATC 2 cut(s) 12, 119
LguI GCTCTTC 1 cut(s) 154
LmnI GCTCC 1 cut(s) 189
LpnPI CCDG 3 cut(s) 33, 221, 257
MaeII ACGT 1 cut(s) 24
MaeIII GTNAC 1 cut(s) 274
MalI GATC 2 cut(s) 14, 121
MboI GATC 2 cut(s) 12, 119
MboII GAAGA 4 cut(s) 70, 78, 171, 201
MluCI AATT 3 cut(s) 7, 33, 62
MnlI CCTC 2 cut(s) 86, 224
MseI TTAA 2 cut(s) 6, 218
MwoI GCNNNNNNNGC 2 cut(s) 170, 268
NdeII GATC 2 cut(s) 12, 119
NlaIII CATG 1 cut(s) 61
NmeAIII GCCGAG 1 cut(s) 190
PciSI GCTCTTC 1 cut(s) 154
PfeI GAWTC 1 cut(s) 191
PshBI ATTAAT 1 cut(s) 6
SapI GCTCTTC 1 cut(s) 154
SaqAI TTAA 2 cut(s) 6, 218
Sau3AI GATC 2 cut(s) 12, 119
SetI ASST 2 cut(s) 27, 276
Sse9I AATT 3 cut(s) 7, 33, 62
StyI CCWWGG 1 cut(s) 95
TaiI ACGT 1 cut(s) 27
TaqI TCGA 2 cut(s) 122, 198
TasI AATT 3 cut(s) 7, 33, 62
TfiI GAWTC 1 cut(s) 191
Tru1I TTAA 2 cut(s) 6, 218
Tru9I TTAA 2 cut(s) 6, 218
TspDTI ATGAA 1 cut(s) 46
VspI ATTAAT 1 cut(s) 6
XapI RAATTY 1 cut(s) 62
XcmI CCANNNNNNNNNTGG 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.