Rroxscaffold_7G00184920

Dolichol-phosphate mannosyltransferase subunit 3 (DPM3)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
24224333 .. 24224833
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00184920.1

Sequence Viewer

Length: 273 bp
ATGAAGCATATTGTGAAAATTCTGACATTGTTGGTGACCATCGCTGCCTTATGGATTGGCCTATTACAAACAGCTATTATTCCACGTAGTCATACTTGGTTGCTTCCCATATATTTCATTGTGTCGCTAGGATGCTATGGGCTTCTAATGGTTGGAGTTGGTTTGGTTCAATTTCGAACTTGTCCTCAAGAAGCAGTATTGTTGCAGCAGGACGTAATTGAGGCCAAGGAATATTTGAAGCAGAAAGGGATCGATGTGGGTGGCTGCGATTGA

Protein Analysis

90

Amino Acids

9.98

Weight (kDa)

7.73

Isoelectric Point (pI)

41.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DPM3 PF08285 1 - 85 2.9e-23 Dolichol-phosphate mannosyltransferase subunit 3 (DPM3)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 257
AcsI RAATTY 1 cut(s) 18
AgsI TTSAA 2 cut(s) 170, 238
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
AlwI GGATC 1 cut(s) 257
AoxI GGCC 2 cut(s) 58, 222
ApeKI GCWGC 3 cut(s) 44, 205, 264
ApoI RAATTY 1 cut(s) 18
AsuHPI GGTGA 1 cut(s) 46
AsuII TTCGAA 1 cut(s) 175
BbvI GCAGC 3 cut(s) 31, 217, 251
BccI CCATC 1 cut(s) 47
BfaI CTAG 1 cut(s) 128
BisI GCNGC 3 cut(s) 45, 206, 265
BlsI GCNGC 3 cut(s) 46, 207, 266
BmsI GCATC 1 cut(s) 122
Bpu14I TTCGAA 1 cut(s) 175
BpuEI CTTGAG 1 cut(s) 171
Bsa29I ATCGAT 1 cut(s) 252
BsaAI YACGTR 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 225
BseCI ATCGAT 1 cut(s) 252
BseDI CCNNGG 1 cut(s) 225
BseGI GGATG 1 cut(s) 137
BseXI GCAGC 3 cut(s) 31, 217, 251
BshFI GGCC 2 cut(s) 60, 224
BshVI ATCGAT 1 cut(s) 252
BsnI GGCC 2 cut(s) 60, 224
Bsp119I TTCGAA 1 cut(s) 175
Bsp143I GATC 1 cut(s) 249
BspANI GGCC 2 cut(s) 60, 224
BspDI ATCGAT 1 cut(s) 252
BspPI GGATC 1 cut(s) 257
BspT104I TTCGAA 1 cut(s) 175
BssECI CCNNGG 1 cut(s) 225
BssMI GATC 1 cut(s) 249
BssT1I CCWWGG 1 cut(s) 225
BstBAI YACGTR 1 cut(s) 86
BstBI TTCGAA 1 cut(s) 175
BstEII GGTNACC 1 cut(s) 34
BstF5I GGATG 1 cut(s) 137
BstKTI GATC 1 cut(s) 252
BstMBI GATC 1 cut(s) 249
BstPI GGTNACC 1 cut(s) 34
BstV1I GCAGC 3 cut(s) 31, 217, 251
Bsu15I ATCGAT 1 cut(s) 252
BsuRI GGCC 2 cut(s) 60, 224
BsuTUI ATCGAT 1 cut(s) 252
BtgZI GCGATG 1 cut(s) 25
BtsCI GGATG 1 cut(s) 137
ClaI ATCGAT 1 cut(s) 252
CviJI RGCY 5 cut(s) 60, 74, 142, 224, 264
CviKI_1 RGCY 5 cut(s) 60, 74, 142, 224, 264
DpnI GATC 1 cut(s) 251
DpnII GATC 1 cut(s) 249
Eco130I CCWWGG 1 cut(s) 225
Eco91I GGTNACC 1 cut(s) 34
EcoO65I GGTNACC 1 cut(s) 34
EcoT14I CCWWGG 1 cut(s) 225
ErhI CCWWGG 1 cut(s) 225
FaiI YATR 6 cut(s) 9, 52, 93, 110, 112, 138
Fnu4HI GCNGC 3 cut(s) 45, 206, 265
FokI GGATG 1 cut(s) 144
Fsp4HI GCNGC 3 cut(s) 45, 206, 265
FspBI CTAG 1 cut(s) 128
GluI GCNGC 3 cut(s) 45, 206, 265
HaeIII GGCC 2 cut(s) 60, 224
HphI GGTGA 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 188
HpyCH4IV ACGT 2 cut(s) 85, 213
HpyCH4V TGCA 1 cut(s) 205
HpySE526I ACGT 2 cut(s) 85, 213
Kzo9I GATC 1 cut(s) 249
LpnPI CCDG 1 cut(s) 194
Lsp1109I GCAGC 3 cut(s) 31, 217, 251
LweI GCATC 1 cut(s) 122
MaeI CTAG 1 cut(s) 128
MaeII ACGT 2 cut(s) 85, 213
MaeIII GTNAC 1 cut(s) 34
MalI GATC 1 cut(s) 251
MboI GATC 1 cut(s) 249
MluCI AATT 3 cut(s) 18, 170, 216
MmeI TCCRAC 1 cut(s) 133
MnlI CCTC 2 cut(s) 195, 214
NdeII GATC 1 cut(s) 249
NmuCI GTSAC 1 cut(s) 34
NspV TTCGAA 1 cut(s) 175
PkrI GCNGC 3 cut(s) 46, 207, 266
Ppu21I YACGTR 1 cut(s) 86
PspEI GGTNACC 1 cut(s) 34
SatI GCNGC 3 cut(s) 45, 206, 265
Sau3AI GATC 1 cut(s) 249
SetI ASST 3 cut(s) 76, 88, 216
SfaNI GCATC 1 cut(s) 122
SfuI TTCGAA 1 cut(s) 175
SgeI CNNG 7 cut(s) 96, 108, 140, 192, 200, 221, 238
SmlI CTYRAG 1 cut(s) 186
SmoI CTYRAG 1 cut(s) 186
Sse9I AATT 3 cut(s) 18, 170, 216
SspI AATATT 1 cut(s) 233
SspMI CTAG 1 cut(s) 128
StyI CCWWGG 1 cut(s) 225
TaiI ACGT 2 cut(s) 88, 216
TaqI TCGA 2 cut(s) 175, 252
TasI AATT 3 cut(s) 18, 170, 216
TseFI GTSAC 1 cut(s) 34
TseI GCWGC 3 cut(s) 44, 205, 264
Tsp45I GTSAC 1 cut(s) 34
TspDTI ATGAA 2 cut(s) 17, 106
XapI RAATTY 1 cut(s) 18
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.