Rh6DG268800

Dolichol-phosphate mannosyltransferase subunit 3 (DPM3)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
46133824 .. 46134325
502 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG268800.1

Sequence Viewer

Length: 273 bp
ATGAAACATATTGTGAAAATTCTGACATTGTTGGTGACCATCTCTGCCTTATGGATTGGCCTATTACAGACAGCTATTATTCCACGTAGTCATACTTGGTTGCTTCCCATATATTTCATTGTGTCGCTAGGATGCTATGGGCTTCTACTGGTTGGAGTTGGTTTGGTACAATTTCCAACTTGTCCTCAAGAAGCAGTATTGTTGCAGCAGGACGTAATTGAGGCCAAGGAATATTTGAAGCAGAAAGGGATCGATGTGGGTGGCTGTGATTGA

Protein Analysis

90

Amino Acids

9.92

Weight (kDa)

6.7

Isoelectric Point (pI)

43.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DPM3 PF08285 1 - 85 1.2e-22 Dolichol-phosphate mannosyltransferase subunit 3 (DPM3)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 257
AcsI RAATTY 1 cut(s) 18
AfaI GTAC 1 cut(s) 168
AgsI TTSAA 1 cut(s) 238
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
AlwI GGATC 1 cut(s) 257
AoxI GGCC 2 cut(s) 58, 222
ApeKI GCWGC 1 cut(s) 205
ApoI RAATTY 1 cut(s) 18
AsuHPI GGTGA 1 cut(s) 46
BbvI GCAGC 1 cut(s) 217
BccI CCATC 1 cut(s) 47
BfaI CTAG 1 cut(s) 128
BisI GCNGC 1 cut(s) 206
BlsI GCNGC 1 cut(s) 207
BmsI GCATC 1 cut(s) 122
BpuEI CTTGAG 1 cut(s) 171
Bsa29I ATCGAT 1 cut(s) 252
BsaAI YACGTR 1 cut(s) 86
BsaJI CCNNGG 1 cut(s) 225
Bse1I ACTGG 1 cut(s) 153
BseCI ATCGAT 1 cut(s) 252
BseDI CCNNGG 1 cut(s) 225
BseGI GGATG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 153
BseXI GCAGC 1 cut(s) 217
BshFI GGCC 2 cut(s) 60, 224
BshVI ATCGAT 1 cut(s) 252
BsnI GGCC 2 cut(s) 60, 224
Bsp143I GATC 1 cut(s) 249
BspANI GGCC 2 cut(s) 60, 224
BspDI ATCGAT 1 cut(s) 252
BspPI GGATC 1 cut(s) 257
BsrI ACTGG 1 cut(s) 153
BssECI CCNNGG 1 cut(s) 225
BssMI GATC 1 cut(s) 249
BssT1I CCWWGG 1 cut(s) 225
BstBAI YACGTR 1 cut(s) 86
BstEII GGTNACC 1 cut(s) 34
BstF5I GGATG 1 cut(s) 137
BstKTI GATC 1 cut(s) 252
BstMBI GATC 1 cut(s) 249
BstPI GGTNACC 1 cut(s) 34
BstV1I GCAGC 1 cut(s) 217
Bsu15I ATCGAT 1 cut(s) 252
BsuRI GGCC 2 cut(s) 60, 224
BsuTUI ATCGAT 1 cut(s) 252
BtsCI GGATG 1 cut(s) 137
ClaI ATCGAT 1 cut(s) 252
Csp6I GTAC 1 cut(s) 167
CviJI RGCY 5 cut(s) 60, 74, 142, 224, 264
CviKI_1 RGCY 5 cut(s) 60, 74, 142, 224, 264
CviQI GTAC 1 cut(s) 167
DpnI GATC 1 cut(s) 251
DpnII GATC 1 cut(s) 249
Eco130I CCWWGG 1 cut(s) 225
Eco91I GGTNACC 1 cut(s) 34
EcoO65I GGTNACC 1 cut(s) 34
EcoT14I CCWWGG 1 cut(s) 225
ErhI CCWWGG 1 cut(s) 225
FaiI YATR 6 cut(s) 9, 52, 93, 110, 112, 138
Fnu4HI GCNGC 1 cut(s) 206
FokI GGATG 1 cut(s) 144
Fsp4HI GCNGC 1 cut(s) 206
FspBI CTAG 1 cut(s) 128
GluI GCNGC 1 cut(s) 206
HaeIII GGCC 2 cut(s) 60, 224
HphI GGTGA 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 1 cut(s) 188
HpyCH4IV ACGT 2 cut(s) 85, 213
HpyCH4V TGCA 1 cut(s) 205
HpySE526I ACGT 2 cut(s) 85, 213
Kzo9I GATC 1 cut(s) 249
LpnPI CCDG 2 cut(s) 134, 194
Lsp1109I GCAGC 1 cut(s) 217
LweI GCATC 1 cut(s) 122
MaeI CTAG 1 cut(s) 128
MaeII ACGT 2 cut(s) 85, 213
MaeIII GTNAC 1 cut(s) 34
MalI GATC 1 cut(s) 251
MboI GATC 1 cut(s) 249
MluCI AATT 3 cut(s) 18, 170, 216
MmeI TCCRAC 2 cut(s) 133, 200
MnlI CCTC 2 cut(s) 195, 214
NdeII GATC 1 cut(s) 249
NmuCI GTSAC 1 cut(s) 34
PkrI GCNGC 1 cut(s) 207
Ppu21I YACGTR 1 cut(s) 86
PspEI GGTNACC 1 cut(s) 34
RsaI GTAC 1 cut(s) 168
RsaNI GTAC 1 cut(s) 167
SatI GCNGC 1 cut(s) 206
Sau3AI GATC 1 cut(s) 249
SetI ASST 3 cut(s) 76, 88, 216
SfaNI GCATC 1 cut(s) 122
SgeI CNNG 8 cut(s) 96, 108, 140, 161, 192, 200, 221, 238
SmlI CTYRAG 1 cut(s) 186
SmoI CTYRAG 1 cut(s) 186
Sse9I AATT 3 cut(s) 18, 170, 216
SspI AATATT 1 cut(s) 233
SspMI CTAG 1 cut(s) 128
StyI CCWWGG 1 cut(s) 225
TaiI ACGT 2 cut(s) 88, 216
TaqI TCGA 1 cut(s) 252
TasI AATT 3 cut(s) 18, 170, 216
TseFI GTSAC 1 cut(s) 34
TseI GCWGC 1 cut(s) 205
Tsp45I GTSAC 1 cut(s) 34
TspDTI ATGAA 2 cut(s) 17, 106
XapI RAATTY 1 cut(s) 18
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.