Rroxscaffold_7G00190330

Trafficking protein particle complex subunit 2-like

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
30425479 .. 30427874
2396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00190330.1

Sequence Viewer

Length: 432 bp
ATGATCGTCTGCGTCGCCGTCGTCGGGCATCAGAACAACCCTCTTTACATCCAGAGCTTCACTGATGCTGATGATGCCCTCAAGCTCCACCACATCGTCCACTGCTCCCTCGACGTCGTCGACGAGCGAGTGAACAATCCGAAGAAGTCCGGACCGACACTGAATGAGACATTCTTGGGTCTGCTTTATCCAACCGAAAATTACAAAGTGTATGGCTATTTGACAAACACGAAGGTCAAGTTTATCTTGGTGACTACCGATCTTGATGTTAAAGATGCAGATGTCAGAAATTTTTTCAGGCGATTCCATGCTGGGTATGTGGATGCAATTTCAAACCCATTCCATGAGCCAGGGAAAAAGATAACCTCAAAAACCTTTGCTGAAAAGGTGAGCACCATTGTCAAGTCATTCGGGTTCAGTTCAACTGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

143

Amino Acids

16.03

Weight (kDa)

7.8

Isoelectric Point (pI)

12.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sedlin_N PF04628 7 - 135 1.1e-37 Sedlin, N-terminal conserved region
Sybindin PF04099 24 - 136 4.1e-08 Sybindin-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 117
AccI GTMKAC 1 cut(s) 120
AccIII TCCGGA 1 cut(s) 149
AcsI RAATTY 1 cut(s) 289
AcyI GRCGYC 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 24
AgsI TTSAA 2 cut(s) 333, 423
AjnI CCWGG 1 cut(s) 349
AluBI AGCT 2 cut(s) 57, 85
AluI AGCT 2 cut(s) 57, 85
Alw21I GWGCWC 1 cut(s) 395
Alw26I GTCTC 1 cut(s) 161
Aor13HI TCCGGA 1 cut(s) 149
ApoI RAATTY 1 cut(s) 289
AspS9I GGNCC 1 cut(s) 152
AsuHPI GGTGA 2 cut(s) 262, 400
AvaII GGWCC 1 cut(s) 152
Bbv12I GWGCWC 1 cut(s) 395
BceAI ACGGC 1 cut(s) 2
BciT130I CCWGG 1 cut(s) 351
BcoDI GTCTC 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 351
Bme18I GGWCC 1 cut(s) 152
BmgT120I GGNCC 1 cut(s) 152
BmrFI CCNGG 1 cut(s) 351
BmsI GCATC 5 cut(s) 37, 55, 64, 265, 313
BpuEI CTTGAG 1 cut(s) 65
BsaHI GRCGYC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 350
BsaWI WCCGGW 1 cut(s) 149
Bsc4I CCNNNNNNNGG 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 430
BseAI TCCGGA 1 cut(s) 149
BseBI CCWGG 1 cut(s) 351
BseDI CCNNGG 1 cut(s) 350
BseGI GGATG 2 cut(s) 48, 328
BseLI CCNNNNNNNGG 1 cut(s) 24
BseNI ACTGG 1 cut(s) 430
BseYI CCCAGC 1 cut(s) 311
BsiHKAI GWGCWC 1 cut(s) 395
BsiSI CCGG 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 24
BsmAI GTCTC 1 cut(s) 161
Bsp1286I GDGCHC 1 cut(s) 395
Bsp13I TCCGGA 1 cut(s) 149
Bsp143I GATC 2 cut(s) 3, 259
BspEI TCCGGA 1 cut(s) 149
BsrI ACTGG 1 cut(s) 430
BssECI CCNNGG 1 cut(s) 350
BssMI GATC 2 cut(s) 3, 259
BssNI GRCGYC 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 351
BstACI GRCGYC 1 cut(s) 114
BstF5I GGATG 2 cut(s) 48, 328
BstKTI GATC 2 cut(s) 6, 262
BstMAI GTCTC 1 cut(s) 161
BstMBI GATC 2 cut(s) 3, 259
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 351
BstSCI CCNGG 1 cut(s) 349
BtsCI GGATG 2 cut(s) 48, 328
BtsI GCAGTG 1 cut(s) 100
BtsIMutI CAGTG 3 cut(s) 60, 100, 158
Cfr13I GGNCC 1 cut(s) 152
CpoI CGGWCCG 1 cut(s) 152
CspI CGGWCCG 1 cut(s) 152
CviAII CATG 2 cut(s) 308, 344
CviJI RGCY 4 cut(s) 57, 85, 216, 349
CviKI_1 RGCY 4 cut(s) 57, 85, 216, 349
DpnI GATC 2 cut(s) 5, 261
DpnII GATC 2 cut(s) 3, 259
Eco47I GGWCC 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 349
FaeI CATG 2 cut(s) 311, 347
FaiI YATR 4 cut(s) 213, 309, 318, 345
FalI AAGNNNNNCTT 2 cut(s) 230, 262
FatI CATG 2 cut(s) 307, 343
FblI GTMKAC 1 cut(s) 120
FokI GGATG 2 cut(s) 35, 335
GsaI CCCAGC 1 cut(s) 315
HapII CCGG 1 cut(s) 150
Hin1I GRCGYC 1 cut(s) 114
Hin1II CATG 2 cut(s) 311, 347
HincII GTYRAC 1 cut(s) 121
HindII GTYRAC 1 cut(s) 121
HinfI GANTC 1 cut(s) 303
HpaII CCGG 1 cut(s) 150
HphI GGTGA 2 cut(s) 262, 400
Hpy166II GTNNAC 3 cut(s) 100, 121, 133
Hpy188I TCNGA 3 cut(s) 33, 141, 287
Hpy188III TCNNGA 3 cut(s) 52, 150, 263
Hpy8I GTNNAC 3 cut(s) 100, 121, 133
Hpy99I CGWCG 7 cut(s) 17, 23, 26, 116, 119, 122, 125
HpyAV CCTTC 1 cut(s) 226
HpyCH4IV ACGT 1 cut(s) 114
HpyCH4V TGCA 2 cut(s) 278, 326
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpySE526I ACGT 1 cut(s) 114
Hsp92I GRCGYC 1 cut(s) 114
Hsp92II CATG 2 cut(s) 311, 347
Kpn2I TCCGGA 1 cut(s) 149
Kzo9I GATC 2 cut(s) 3, 259
LmnI GCTCC 2 cut(s) 90, 110
LpnPI CCDG 7 cut(s) 65, 163, 283, 297, 336, 363, 411
LweI GCATC 5 cut(s) 37, 55, 64, 265, 313
MaeII ACGT 1 cut(s) 114
MaeIII GTNAC 1 cut(s) 250
MalI GATC 2 cut(s) 5, 261
MboI GATC 2 cut(s) 3, 259
MboII GAAGA 1 cut(s) 154
MhlI GDGCHC 1 cut(s) 395
MluCI AATT 3 cut(s) 199, 289, 327
MmeI TCCRAC 1 cut(s) 215
MnlI CCTC 4 cut(s) 51, 89, 119, 376
MroI TCCGGA 1 cut(s) 149
MseI TTAA 1 cut(s) 270
MspI CCGG 1 cut(s) 150
MspR9I CCNGG 1 cut(s) 351
MvaI CCWGG 1 cut(s) 351
MwoI GCNNNNNNNGC 1 cut(s) 74
NdeII GATC 2 cut(s) 3, 259
NlaIII CATG 2 cut(s) 311, 347
NmuCI GTSAC 1 cut(s) 250
PcsI WCGNNNNNNNCGW 2 cut(s) 117, 120
PfeI GAWTC 1 cut(s) 303
PflFI GACNNNGTC 1 cut(s) 116
Psp6I CCWGG 1 cut(s) 349
PspFI CCCAGC 1 cut(s) 311
PspGI CCWGG 1 cut(s) 349
PspPI GGNCC 1 cut(s) 152
PsyI GACNNNGTC 1 cut(s) 116
Rsr2I CGGWCCG 1 cut(s) 152
RsrII CGGWCCG 1 cut(s) 152
SalI GTCGAC 1 cut(s) 119
SaqAI TTAA 1 cut(s) 270
Sau3AI GATC 2 cut(s) 3, 259
Sau96I GGNCC 1 cut(s) 152
ScrFI CCNGG 1 cut(s) 351
SduI GDGCHC 1 cut(s) 395
SetI ASST 7 cut(s) 59, 87, 117, 237, 368, 377, 390
SfaNI GCATC 5 cut(s) 37, 55, 64, 265, 313
SgrDI CGTCGACG 1 cut(s) 119
SinI GGWCC 1 cut(s) 152
SmlI CTYRAG 1 cut(s) 80
SmoI CTYRAG 1 cut(s) 80
Sse9I AATT 3 cut(s) 199, 289, 327
StyD4I CCNGG 1 cut(s) 349
TaiI ACGT 1 cut(s) 117
TaqI TCGA 2 cut(s) 111, 120
TaqII GACCGA 1 cut(s) 169
TasI AATT 3 cut(s) 199, 289, 327
TfiI GAWTC 1 cut(s) 303
Tru1I TTAA 1 cut(s) 270
Tru9I TTAA 1 cut(s) 270
TscAI CASTG 3 cut(s) 67, 107, 165
TseFI GTSAC 1 cut(s) 250
Tsp45I GTSAC 1 cut(s) 250
TspRI CASTG 3 cut(s) 67, 107, 165
Tth111I GACNNNGTC 1 cut(s) 116
VpaK11BI GGWCC 1 cut(s) 152
XapI RAATTY 1 cut(s) 289
XmiI GTMKAC 1 cut(s) 120
ZraI GACGTC 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.